ID: 1153591354

View in Genome Browser
Species Human (GRCh38)
Location 18:6676606-6676628
Sequence CATCCAGGAGACCTTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153591350_1153591354 -4 Left 1153591350 18:6676587-6676609 CCCTGACTCTTCCAGGGCACATC No data
Right 1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG No data
1153591345_1153591354 9 Left 1153591345 18:6676574-6676596 CCCAACACCACATCCCTGACTCT No data
Right 1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG No data
1153591348_1153591354 2 Left 1153591348 18:6676581-6676603 CCACATCCCTGACTCTTCCAGGG No data
Right 1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG No data
1153591344_1153591354 26 Left 1153591344 18:6676557-6676579 CCTGGCAGGAAGTGCTGCCCAAC No data
Right 1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG No data
1153591351_1153591354 -5 Left 1153591351 18:6676588-6676610 CCTGACTCTTCCAGGGCACATCC No data
Right 1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG No data
1153591346_1153591354 8 Left 1153591346 18:6676575-6676597 CCAACACCACATCCCTGACTCTT No data
Right 1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG No data
1153591343_1153591354 29 Left 1153591343 18:6676554-6676576 CCTCCTGGCAGGAAGTGCTGCCC No data
Right 1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153591354 Original CRISPR CATCCAGGAGACCTTGCTGC AGG Intergenic
No off target data available for this crispr