ID: 1153595530

View in Genome Browser
Species Human (GRCh38)
Location 18:6721340-6721362
Sequence CTGGAGACAAAGCTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153595530_1153595537 24 Left 1153595530 18:6721340-6721362 CCTGTCTCCAGCTTTGTCTCCAG No data
Right 1153595537 18:6721387-6721409 TCTAGCAAAGCTAAACTAAAAGG No data
1153595530_1153595538 25 Left 1153595530 18:6721340-6721362 CCTGTCTCCAGCTTTGTCTCCAG No data
Right 1153595538 18:6721388-6721410 CTAGCAAAGCTAAACTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153595530 Original CRISPR CTGGAGACAAAGCTGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr