ID: 1153596367

View in Genome Browser
Species Human (GRCh38)
Location 18:6729603-6729625
Sequence CCCACGGGCTGGAGTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153596367_1153596381 14 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596367_1153596380 13 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596380 18:6729639-6729661 GTCTGCGAATTCGCGCGCCCGGG No data
1153596367_1153596386 23 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596386 18:6729649-6729671 TCGCGCGCCCGGGGCGGGGCGGG No data
1153596367_1153596379 12 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596379 18:6729638-6729660 CGTCTGCGAATTCGCGCGCCCGG No data
1153596367_1153596384 19 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596384 18:6729645-6729667 GAATTCGCGCGCCCGGGGCGGGG No data
1153596367_1153596382 17 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596382 18:6729643-6729665 GCGAATTCGCGCGCCCGGGGCGG No data
1153596367_1153596383 18 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596383 18:6729644-6729666 CGAATTCGCGCGCCCGGGGCGGG No data
1153596367_1153596385 22 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596385 18:6729648-6729670 TTCGCGCGCCCGGGGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153596367 Original CRISPR CCCACGGGCTGGAGTGGGGG CGG (reversed) Intergenic
No off target data available for this crispr