ID: 1153596369

View in Genome Browser
Species Human (GRCh38)
Location 18:6729606-6729628
Sequence ACGCCCACGGGCTGGAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153596369_1153596384 16 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596384 18:6729645-6729667 GAATTCGCGCGCCCGGGGCGGGG No data
1153596369_1153596381 11 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596369_1153596380 10 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596380 18:6729639-6729661 GTCTGCGAATTCGCGCGCCCGGG No data
1153596369_1153596390 30 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596369_1153596382 14 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596382 18:6729643-6729665 GCGAATTCGCGCGCCCGGGGCGG No data
1153596369_1153596389 29 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596389 18:6729658-6729680 CGGGGCGGGGCGGGCCTGCCCGG No data
1153596369_1153596379 9 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596379 18:6729638-6729660 CGTCTGCGAATTCGCGCGCCCGG No data
1153596369_1153596383 15 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596383 18:6729644-6729666 CGAATTCGCGCGCCCGGGGCGGG No data
1153596369_1153596386 20 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596386 18:6729649-6729671 TCGCGCGCCCGGGGCGGGGCGGG No data
1153596369_1153596385 19 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596385 18:6729648-6729670 TTCGCGCGCCCGGGGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153596369 Original CRISPR ACGCCCACGGGCTGGAGTGG GGG (reversed) Intergenic