ID: 1153596373

View in Genome Browser
Species Human (GRCh38)
Location 18:6729609-6729631
Sequence ACCACGCCCACGGGCTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153596373_1153596382 11 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596382 18:6729643-6729665 GCGAATTCGCGCGCCCGGGGCGG No data
1153596373_1153596380 7 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596380 18:6729639-6729661 GTCTGCGAATTCGCGCGCCCGGG No data
1153596373_1153596383 12 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596383 18:6729644-6729666 CGAATTCGCGCGCCCGGGGCGGG No data
1153596373_1153596379 6 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596379 18:6729638-6729660 CGTCTGCGAATTCGCGCGCCCGG No data
1153596373_1153596391 28 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596391 18:6729660-6729682 GGGCGGGGCGGGCCTGCCCGGGG No data
1153596373_1153596384 13 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596384 18:6729645-6729667 GAATTCGCGCGCCCGGGGCGGGG No data
1153596373_1153596389 26 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596389 18:6729658-6729680 CGGGGCGGGGCGGGCCTGCCCGG No data
1153596373_1153596381 8 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596373_1153596386 17 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596386 18:6729649-6729671 TCGCGCGCCCGGGGCGGGGCGGG No data
1153596373_1153596390 27 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596373_1153596385 16 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596385 18:6729648-6729670 TTCGCGCGCCCGGGGCGGGGCGG No data
1153596373_1153596392 29 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596392 18:6729661-6729683 GGCGGGGCGGGCCTGCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153596373 Original CRISPR ACCACGCCCACGGGCTGGAG TGG (reversed) Intergenic