ID: 1153596381

View in Genome Browser
Species Human (GRCh38)
Location 18:6729640-6729662
Sequence TCTGCGAATTCGCGCGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153596371_1153596381 9 Left 1153596371 18:6729608-6729630 CCCACTCCAGCCCGTGGGCGTGG No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596374_1153596381 3 Left 1153596374 18:6729614-6729636 CCAGCCCGTGGGCGTGGTTCCCA No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596376_1153596381 -2 Left 1153596376 18:6729619-6729641 CCGTGGGCGTGGTTCCCAGCGTC No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596373_1153596381 8 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596375_1153596381 -1 Left 1153596375 18:6729618-6729640 CCCGTGGGCGTGGTTCCCAGCGT No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596367_1153596381 14 Left 1153596367 18:6729603-6729625 CCGCCCCCACTCCAGCCCGTGGG No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596365_1153596381 15 Left 1153596365 18:6729602-6729624 CCCGCCCCCACTCCAGCCCGTGG No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596370_1153596381 10 Left 1153596370 18:6729607-6729629 CCCCACTCCAGCCCGTGGGCGTG No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data
1153596369_1153596381 11 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596381 18:6729640-6729662 TCTGCGAATTCGCGCGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153596381 Original CRISPR TCTGCGAATTCGCGCGCCCG GGG Intergenic