ID: 1153596390

View in Genome Browser
Species Human (GRCh38)
Location 18:6729659-6729681
Sequence GGGGCGGGGCGGGCCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153596373_1153596390 27 Left 1153596373 18:6729609-6729631 CCACTCCAGCCCGTGGGCGTGGT No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596378_1153596390 2 Left 1153596378 18:6729634-6729656 CCAGCGTCTGCGAATTCGCGCGC No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596377_1153596390 3 Left 1153596377 18:6729633-6729655 CCCAGCGTCTGCGAATTCGCGCG No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596375_1153596390 18 Left 1153596375 18:6729618-6729640 CCCGTGGGCGTGGTTCCCAGCGT No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596371_1153596390 28 Left 1153596371 18:6729608-6729630 CCCACTCCAGCCCGTGGGCGTGG No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596370_1153596390 29 Left 1153596370 18:6729607-6729629 CCCCACTCCAGCCCGTGGGCGTG No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596369_1153596390 30 Left 1153596369 18:6729606-6729628 CCCCCACTCCAGCCCGTGGGCGT No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596374_1153596390 22 Left 1153596374 18:6729614-6729636 CCAGCCCGTGGGCGTGGTTCCCA No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data
1153596376_1153596390 17 Left 1153596376 18:6729619-6729641 CCGTGGGCGTGGTTCCCAGCGTC No data
Right 1153596390 18:6729659-6729681 GGGGCGGGGCGGGCCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153596390 Original CRISPR GGGGCGGGGCGGGCCTGCCC GGG Intergenic