ID: 1153600203

View in Genome Browser
Species Human (GRCh38)
Location 18:6773606-6773628
Sequence CCTTCTGACCATAAGTTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153600203 Original CRISPR CCTTCTGACCATAAGTTGCG TGG Intronic
910892416 1:92031120-92031142 CCTTCTGAACTTCAGCTGCGGGG - Intronic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919738536 1:200968820-200968842 CCTTCTTTCCATAAGTGGCAAGG + Intergenic
921623574 1:217353504-217353526 GCTCCTCACCATAAGTTGCAAGG + Intergenic
922351730 1:224739600-224739622 CCTTCTGAGCATCAGTGGTGTGG + Exonic
1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG + Intergenic
1083304290 11:61754631-61754653 CCTCCTGACCATGGGTTGGGGGG + Intronic
1084524404 11:69686769-69686791 CCTTCTCCCCATGAGTTGTGTGG - Intergenic
1084661986 11:70551355-70551377 CAGTCTGACCCTAAGCTGCGTGG + Intronic
1090749295 11:129731865-129731887 CCTCCTGACCTTTAGATGCGTGG - Intergenic
1097904319 12:64904453-64904475 CCTTCTGTCAATAACTTGCTTGG + Intergenic
1103657800 12:122487392-122487414 CCTTCTGACCCTAAGGTTCTGGG - Intronic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1118041295 14:61920000-61920022 CTTTCTGAGCATAAATTGAGAGG - Intergenic
1125087284 15:35745185-35745207 CCTTTTGACCATAGGCTGCCTGG - Intergenic
1139260797 16:65591661-65591683 GGTTCTGACAATAAGTTGTGGGG - Intergenic
1140956522 16:79871427-79871449 CCTTCTGAGCAGAGGTTGTGAGG + Intergenic
1141327025 16:83070330-83070352 CCTTCTGGCCATAAGTACCAAGG + Intronic
1142550384 17:734724-734746 CCTTCTGCCTATAATTTGGGGGG - Intronic
1148717669 17:49727511-49727533 GCTTCTGACCATGAGTGGCATGG + Intronic
1153600203 18:6773606-6773628 CCTTCTGACCATAAGTTGCGTGG + Intronic
1153834616 18:8952583-8952605 CCTTTTGACCAGAATTTGCTGGG + Intergenic
1159619529 18:70621203-70621225 CATTCTGACTATAAGATGTGAGG + Intergenic
1159983705 18:74817237-74817259 CTTTCTGACCATGAATTGCAGGG + Intronic
1168301602 19:55407916-55407938 GCTTCTGACCATAGTTTGCGGGG - Intergenic
931871855 2:66469336-66469358 CCTTCTGCCTATAGGTTGCCTGG - Intronic
935224025 2:101037975-101037997 CCTCCTGTCCATAAGCTGAGGGG - Intronic
941356852 2:164504442-164504464 CCTGCTGACAAGAAGTTGCCAGG + Intronic
1174565346 20:51460844-51460866 CCTTCTGACCCTGCGTTGCTGGG - Intronic
1177905662 21:26968313-26968335 CCTTCTAACCATAAGTCGTCGGG - Intergenic
954394451 3:50286083-50286105 CTTTCTGACCAGAAGATGCCAGG + Intronic
963026794 3:140927668-140927690 AATTCTGACTATAAGTTGTGGGG + Intergenic
980968701 4:139548842-139548864 CCTTCTGACCATTAATTTCCTGG - Intronic
985879668 5:2628711-2628733 CCTCCTGACCATAATTAGGGAGG - Intergenic
1002459591 5:179366699-179366721 CCTCCTGACCCTAAGGTGTGAGG + Intergenic
1006144271 6:31948948-31948970 CCTTCTGACCATCAGTCATGAGG - Exonic
1015989093 6:138916940-138916962 CCTTCTGACTCTAAGCTGCTTGG + Intronic
1017965443 6:159260663-159260685 CCTGTCAACCATAAGTTGCGTGG + Intronic
1020508993 7:9028815-9028837 CCTTCTGATCATAAAATGTGTGG + Intergenic
1025039342 7:55626693-55626715 CCTTGTGACATTAAGTTGCAGGG - Intergenic
1026737382 7:72957645-72957667 CCCTCAGACCATAAGTGGTGAGG + Intergenic
1027106350 7:75407423-75407445 CCCTCAGACCATAAGTGGTGAGG - Intronic
1045472243 8:102522956-102522978 CCTTCTGGCCACAAGTGGGGTGG - Intergenic
1047172649 8:122508951-122508973 TTATCTGACCATAAGTTGAGTGG - Intergenic
1190169410 X:48100013-48100035 CCTTCTGACCCAAGGTTGGGTGG - Intergenic