ID: 1153607789

View in Genome Browser
Species Human (GRCh38)
Location 18:6852687-6852709
Sequence GACCTAATCCTTATTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153607787_1153607789 -8 Left 1153607787 18:6852672-6852694 CCGCCTTAGCACGTGGACCTAAT 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG 0: 1
1: 1
2: 1
3: 6
4: 84
1153607785_1153607789 4 Left 1153607785 18:6852660-6852682 CCTTTCGTGTTGCCGCCTTAGCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG 0: 1
1: 1
2: 1
3: 6
4: 84
1153607784_1153607789 29 Left 1153607784 18:6852635-6852657 CCTTAGCATGGACTAACAACTTT 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG 0: 1
1: 1
2: 1
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153607789 Original CRISPR GACCTAATCCTTATTCTTAC AGG Intronic
901344209 1:8524720-8524742 GTCCTAAATCTTATTCTGACTGG + Intronic
903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG + Intronic
907849450 1:58240360-58240382 CACCATATCCTTATTCTAACTGG - Intronic
908080037 1:60567154-60567176 GACATAAGCCTTCTTCTTCCTGG + Intergenic
909744382 1:79075314-79075336 GAAATACTCCTTATTGTTACTGG + Intergenic
910165601 1:84324569-84324591 GACACCACCCTTATTCTTACGGG - Intronic
916503836 1:165409690-165409712 GACCTCCTCCTTATCCTTGCAGG - Exonic
922500834 1:226095790-226095812 GACCTTATCCTAATTTTTATGGG + Intergenic
1063166583 10:3469028-3469050 GACCTAATCTTTAGTATTAGAGG + Intergenic
1064830353 10:19457885-19457907 CAAATAATCCTTATTGTTACAGG + Intronic
1068830524 10:61489740-61489762 GACCTGATCCCCATTCTTAGTGG + Intergenic
1070039836 10:72765492-72765514 GACTTATTGCTTATTCTTCCTGG - Intronic
1071063945 10:81608589-81608611 TAGCTAATACTTATTGTTACTGG + Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1073604295 10:104878596-104878618 TACCTAACCCTTATTCTAATTGG - Intronic
1076237650 10:128877909-128877931 GTTCCAATCCTTATTCTTGCAGG + Intergenic
1079821648 11:25139097-25139119 GAGATAATCCTTAATCATACAGG + Intergenic
1080777773 11:35402222-35402244 GTTCTAATCCTTAGTCTTTCTGG - Intronic
1083288597 11:61677081-61677103 GACCTAAGCCTTCTTCTTGAGGG - Intergenic
1084995169 11:72969887-72969909 GACCTGACCCTCATTATTACAGG + Intronic
1087667274 11:101065165-101065187 GACCTAGCCCCTATCCTTACAGG - Intronic
1096326612 12:50668236-50668258 GACATAGTCCCTATTCTTATGGG - Intronic
1096668524 12:53183258-53183280 GTCATAATGCTTATCCTTACAGG - Intronic
1096938746 12:55316489-55316511 AACCTAAGCCATATTCTTCCAGG + Intergenic
1097971340 12:65636349-65636371 GAACTAATCCATCTTCTTTCAGG - Intergenic
1099872215 12:88364039-88364061 AACCAACTCCTTATTCATACTGG + Intergenic
1101604374 12:106236890-106236912 GACCTCATCCTTGCTCTAACTGG - Intergenic
1105534601 13:21253634-21253656 AACCTAATTCTTATTCTGATCGG + Intergenic
1107256106 13:38428406-38428428 GTCCTAATCCCTTTTCTTACAGG + Intergenic
1110029839 13:70595609-70595631 ATCCTAATACTTTTTCTTACAGG - Intergenic
1121600893 14:95202256-95202278 GACATAATCGCCATTCTTACTGG + Intronic
1140521273 16:75584223-75584245 GACCTAATTCCTATTCTCATTGG - Intergenic
1140882705 16:79213370-79213392 TACGTAATCCTTATTATCACAGG + Intergenic
1147491657 17:40873582-40873604 GACATAATCCTATTTCTGACAGG - Intergenic
1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG + Intronic
1158329055 18:56341422-56341444 GAACAACTCCTTATTCTAACAGG + Intergenic
1164459757 19:28436815-28436837 GACCAAATCCATTTTCTTACAGG - Intergenic
925504654 2:4548147-4548169 TACCTAATCCATATTATTAGTGG + Intergenic
929035428 2:37686902-37686924 GTCCTAACCCATGTTCTTACTGG - Intronic
932851540 2:75192299-75192321 TACCTTATCCTTATACTTACTGG + Intronic
933322624 2:80796327-80796349 AACCTAGCACTTATTCTTACAGG + Intergenic
934692683 2:96373872-96373894 GACCTAGTCCTTACCCTTAGGGG + Intergenic
936006782 2:108896222-108896244 GAGGTCATCCATATTCTTACAGG - Exonic
945886780 2:215384184-215384206 GAACTAACCCTTTTTCATACAGG - Exonic
947247171 2:228061568-228061590 GACCTAATTATTATTATTATTGG + Intronic
1175026625 20:55909501-55909523 GACCTAATCCTAATCTTTATGGG + Intergenic
1177193338 21:17876056-17876078 GACTTAGTCCTTTTTCTTCCTGG + Intergenic
1177290222 21:19101793-19101815 GACCTTGTACTTCTTCTTACTGG + Intergenic
1184128650 22:42504283-42504305 GACATGATCCTTATCCTTATGGG - Intergenic
1184137445 22:42557598-42557620 GACATGATCCTTATCCTTATGGG - Intronic
951395274 3:22157492-22157514 GACCTAGATCTTATTCTCACTGG - Intronic
952522740 3:34178423-34178445 GTACTAATGCTTATTTTTACTGG - Intergenic
952727137 3:36597982-36598004 CACCTAATACTTATCCTTCCAGG + Intergenic
959228290 3:103614949-103614971 GACCTGACATTTATTCTTACAGG + Intergenic
961470184 3:127106496-127106518 GACCTGTTCCTTTTTCTTACAGG - Intergenic
963364267 3:144314887-144314909 CTTCTAATCCTTATTATTACCGG + Intergenic
965710943 3:171555644-171555666 GTACTAATCCTTCTTCTTTCTGG + Intergenic
969172312 4:5373974-5373996 GACCTCATCCTTATTCTTACCGG - Intronic
970098589 4:12493654-12493676 GACTTTATCCTGAATCTTACTGG - Intergenic
971124003 4:23732590-23732612 GTCATAAGCTTTATTCTTACTGG + Intergenic
975325099 4:73050252-73050274 GAACTAATCCTTTTCCTTAGGGG + Intergenic
975744005 4:77457964-77457986 GACTTCATCCTTATTTTTTCAGG - Intergenic
977449257 4:97174370-97174392 GCCCAAATCCTTCATCTTACTGG - Intergenic
977959352 4:103068238-103068260 GAGCCAATCCGTAGTCTTACAGG - Intronic
981833395 4:149027890-149027912 GACATAATCCTTATGCTTCTGGG - Intergenic
985061503 4:186083974-186083996 GACCCAATCCTTATCTTTATAGG - Exonic
987153450 5:15063547-15063569 GACCCAAACCTTATTCCTAAAGG - Intergenic
996189823 5:120526283-120526305 GCCCTAATTCGTGTTCTTACTGG - Intronic
996575475 5:124972947-124972969 GTCCTTATCCTTAATCTAACGGG + Intergenic
997848196 5:137307204-137307226 GACATGATCCTTATTCTCACAGG + Intronic
999013144 5:148065353-148065375 AACCTGATCTTCATTCTTACTGG - Exonic
1007413057 6:41675899-41675921 GCCCTAATCCCTCTTCCTACAGG + Intergenic
1014602192 6:123427457-123427479 AATGTAATCCTTCTTCTTACAGG + Intronic
1016553376 6:145308065-145308087 GGCCTAGTCCTTATTCTTGAGGG - Intergenic
1021649939 7:22823096-22823118 GTCCTAACTCTTATTCCTACTGG + Intergenic
1021704229 7:23351106-23351128 GAGCTAATCCTCATTCTCAAAGG - Intronic
1026675230 7:72423171-72423193 CACCTAATCTTAATTTTTACTGG + Intronic
1028618465 7:92797673-92797695 GTCCTGATCTTTATTCTTATAGG - Intronic
1030541232 7:110832897-110832919 GCCCTAATCCTTTCTCCTACTGG - Intronic
1037436465 8:18869078-18869100 GACCAAATGCTTGTTCTTAATGG + Intronic
1038660398 8:29492065-29492087 GCCCTAATTCTTATCCTTTCAGG + Intergenic
1041550723 8:59097821-59097843 GAGATAATCTTTATGCTTACAGG - Intronic
1041569987 8:59326879-59326901 TACCTAATTCTAATTCTTAAAGG + Intergenic
1042369009 8:67969485-67969507 GTCCTAATCCTTATTATTATGGG - Intronic
1045721493 8:105116075-105116097 GACTTAAACCATATTCTTAAAGG - Intronic
1045758671 8:105575704-105575726 GACCTAATACATACTCTGACAGG - Intronic
1047371950 8:124263424-124263446 GACCTAATCCTAATACCTATTGG + Intergenic
1052837012 9:33258390-33258412 GAGCTAGTCCTAATCCTTACTGG + Intronic
1188181693 X:27064065-27064087 GACCTGAAGCTTAATCTTACTGG + Intergenic
1189920070 X:45894971-45894993 TCCCTAAGCCTAATTCTTACAGG + Intergenic
1190972581 X:55365953-55365975 GACCTAATACTTATACTTACTGG - Intergenic
1194247064 X:91528059-91528081 CCACTAATCCTTTTTCTTACAGG + Intergenic
1197168564 X:123406438-123406460 GAGCTATACCTTATTCTTGCTGG - Intronic