ID: 1153608960

View in Genome Browser
Species Human (GRCh38)
Location 18:6862359-6862381
Sequence CGGGGCCCCCTGAAGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153608960_1153608963 -6 Left 1153608960 18:6862359-6862381 CCCCAAGACTTCAGGGGGCCCCG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1153608963 18:6862376-6862398 GCCCCGACAACTTGCCCTACTGG 0: 1
1: 0
2: 0
3: 4
4: 36
1153608960_1153608970 23 Left 1153608960 18:6862359-6862381 CCCCAAGACTTCAGGGGGCCCCG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1153608970 18:6862405-6862427 TGTTGTAAAATGGTAAAAGAAGG 0: 1
1: 0
2: 1
3: 41
4: 445
1153608960_1153608969 13 Left 1153608960 18:6862359-6862381 CCCCAAGACTTCAGGGGGCCCCG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1153608969 18:6862395-6862417 CTGGAATTTATGTTGTAAAATGG 0: 1
1: 1
2: 2
3: 31
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153608960 Original CRISPR CGGGGCCCCCTGAAGTCTTG GGG (reversed) Intronic
900719137 1:4163871-4163893 CGGGGTCCCCTGAGGCCTTCGGG - Intergenic
901614284 1:10525873-10525895 CTTGGCCCCCTAAAGTGTTGAGG + Intronic
901638720 1:10682403-10682425 CCGGGCCCCCAGGAGTCTTCCGG - Intronic
903189814 1:21650356-21650378 GGGGTACCCCTGAAGTCTTAGGG - Intronic
904053657 1:27656205-27656227 CGGGGTCCCCTGCAGTTTTAGGG + Intergenic
904258824 1:29275314-29275336 AGGGGTCCCCTGAGCTCTTGGGG + Intronic
905409844 1:37761250-37761272 AGGAGAGCCCTGAAGTCTTGTGG - Intronic
915172089 1:153985443-153985465 AGGGGCCCCCAGCAGGCTTGGGG - Intronic
919371113 1:196727248-196727270 CTTGGCCTCCTGAAGTGTTGAGG - Intronic
1069598279 10:69686802-69686824 CTGTTCCCACTGAAGTCTTGAGG - Intronic
1075120071 10:119658379-119658401 CGGGCGTCCCTGCAGTCTTGGGG + Intronic
1075668342 10:124246254-124246276 CGGGGCTCCCTGAGGTCCGGCGG - Intergenic
1077315777 11:1918814-1918836 CGGTGCCACCTGGAGTCCTGAGG + Intergenic
1083616623 11:64029453-64029475 CCTGGCTCCCTGATGTCTTGGGG + Intronic
1089573087 11:119422905-119422927 CGTGGCACCCTGATGTCTTTCGG - Intronic
1092204191 12:6605940-6605962 CTGGGACCCCTGGAGGCTTGTGG - Intronic
1094386078 12:29895552-29895574 TGGGGCCACCTGAGGCCTTGGGG - Intergenic
1096556482 12:52407040-52407062 TGGGGGCCCCAGAAGTGTTGAGG - Intergenic
1096875724 12:54628863-54628885 TGAGGCTGCCTGAAGTCTTGGGG + Intergenic
1101492632 12:105223420-105223442 GGTGGTTCCCTGAAGTCTTGGGG - Intronic
1104856266 12:131903830-131903852 TGGTGCCCCCTGAGGTTTTGGGG + Intronic
1105418951 13:20236062-20236084 AGGGGCTGCCTGAGGTCTTGAGG - Intergenic
1105557202 13:21458836-21458858 CTGGGGCTCCTGAAGCCTTGCGG - Intronic
1107888220 13:44892070-44892092 CGGGTCCCTCTGAAGTCCTGGGG + Intergenic
1111631132 13:90847349-90847371 TGGGACCCCATTAAGTCTTGTGG + Intergenic
1114625130 14:24123874-24123896 AGGGGCCACATGAAGCCTTGTGG - Exonic
1115311730 14:31985032-31985054 TGGGGCTCCCTGTGGTCTTGAGG + Intergenic
1118736520 14:68705153-68705175 CTGGGGCTCCTGAATTCTTGGGG - Intronic
1122628616 14:103097348-103097370 CGGGGCCCCCTGGACTCTCCGGG + Intergenic
1122647423 14:103204530-103204552 GGAGGTCCCCTGAAGTCCTGAGG + Intergenic
1122798488 14:104218189-104218211 CTGGGCCCCCTGAAGTGAAGTGG + Intergenic
1124492582 15:30167321-30167343 CCGGGCCTCCAGGAGTCTTGGGG - Intergenic
1124750952 15:32371004-32371026 CCGGGCCTCCAGGAGTCTTGGGG + Intergenic
1132887101 16:2187086-2187108 AGGGGGCCCCCGAAGTCCTGCGG + Intronic
1136051410 16:27653251-27653273 AGGGCCACCCTGAAGTCTTCTGG + Intronic
1147122412 17:38343493-38343515 CGCTGCCCCCTGTAGGCTTGGGG + Exonic
1148554864 17:48572468-48572490 CCTGGCCCTCTGAAGCCTTGTGG + Intronic
1152543782 17:80990654-80990676 AGGGGGCCCCTGAATTTTTGTGG - Intergenic
1153608960 18:6862359-6862381 CGGGGCCCCCTGAAGTCTTGGGG - Intronic
1158226211 18:55204292-55204314 ATGGGTCCCTTGAAGTCTTGTGG - Intergenic
1159057639 18:63481936-63481958 CGAGGCCCCCTGAAGTCAGGTGG - Intronic
1160594646 18:79964990-79965012 GGGGGGCCCCTGAAGACCTGGGG + Intronic
1160810994 19:1012865-1012887 CCGGGGCCTCTGAAGTGTTGGGG - Intronic
1160902149 19:1433967-1433989 CTGGGCCCGCTGAAGGCTTGTGG - Intronic
1161988570 19:7670838-7670860 CTGGGGCTCCTGGAGTCTTGGGG - Intergenic
1163625759 19:18388564-18388586 CGGCGCCCCCTGGCGGCTTGCGG - Exonic
1165021575 19:32928687-32928709 TGGGGCTCCTTGGAGTCTTGTGG - Intronic
929699677 2:44151136-44151158 TGGGGCTGCCTGAGGTCTTGAGG + Intergenic
932201200 2:69829859-69829881 CTGGGCTCCCTGAAGTCTCGGGG + Exonic
932216152 2:69967280-69967302 CGGGGCACACTGGAGTCTTCCGG + Intergenic
933830388 2:86202935-86202957 CGGGGCCTCCCAAAGTGTTGGGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
943972434 2:194428154-194428176 TGGGGCCGCCTGAAGGCTTGGGG - Intergenic
944890457 2:204111737-204111759 CTTGGCCCCCTGAAGTTTTAGGG - Intergenic
946342229 2:219077725-219077747 CTCGGCCTCCTGAAGTCCTGAGG + Intronic
946469124 2:219940045-219940067 CAGGGTCCCCTGGAATCTTGGGG + Intergenic
948919257 2:241053684-241053706 CCTGGCCCCTTGAAGACTTGTGG + Intronic
1170029686 20:11931842-11931864 AGGGGCCCCGTGAAGCCTAGTGG - Intergenic
1171416283 20:24982814-24982836 GGGGGTCCCCTGATGTGTTGAGG - Intronic
1173518237 20:43680277-43680299 CTCGGCCTCCTGAAGTGTTGGGG + Intronic
1175171131 20:57082275-57082297 TGGGGGACCCTGAAGACTTGGGG + Intergenic
1182512298 22:30828017-30828039 GGGGACCCGCTGAACTCTTGAGG + Intronic
1183978814 22:41528033-41528055 CGGGTCCCCCTGAGGTGGTGGGG + Exonic
1185030566 22:48440864-48440886 GGGAGCCCCCTCCAGTCTTGAGG + Intergenic
1185339852 22:50286386-50286408 CAGGGCCCCCTGAAGACCAGGGG - Intronic
950818950 3:15737715-15737737 CTTGGCCTCCTGAAGTGTTGGGG + Intronic
950853941 3:16088171-16088193 CAGGGCCCCCTTAAGACTTGTGG + Intergenic
954135745 3:48581401-48581423 AGGGGACCCCAGAAGCCTTGAGG + Intronic
955087258 3:55715261-55715283 CGAGGTCCCCTGGATTCTTGGGG - Intronic
959484218 3:106908753-106908775 CTTGGCCCCCTGCAGACTTGAGG + Intergenic
961373316 3:126445830-126445852 CGGTACACCCTGAAGTCTGGTGG + Intronic
966964867 3:184981057-184981079 CTTGGCCCCCTGAAATCTTCCGG - Intronic
969871031 4:10104955-10104977 TGGGGGCCCCTCAGGTCTTGAGG - Intronic
970169767 4:13278099-13278121 CGGGGACCCTTGAAGTCCTTGGG - Intergenic
974525719 4:63047727-63047749 CAGGGCTGCCTGAGGTCTTGGGG - Intergenic
983634438 4:169882975-169882997 CAGGGCCTCCTGAGATCTTGGGG + Intergenic
985544721 5:503908-503930 CTGGGCCCCCAGAGCTCTTGGGG + Intronic
986104748 5:4649156-4649178 CGGGGGCCCCTGAGAACTTGTGG + Intergenic
986215188 5:5713007-5713029 GGGGGCCCCCTGTGCTCTTGAGG - Intergenic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
997379341 5:133424122-133424144 AGGTGTCCCCTGAAATCTTGGGG - Intronic
998042575 5:138961697-138961719 CTGTGCCCCCTGAAGCCATGTGG + Intronic
1002289041 5:178187311-178187333 CTGGGCTCCCTGAAGTCCTGGGG - Intergenic
1003837053 6:10082765-10082787 TAGGGTCCACTGAAGTCTTGGGG - Intronic
1005932507 6:30493991-30494013 CGGGGCTACCTGAGGCCTTGGGG + Exonic
1006333143 6:33406330-33406352 TGGGGCCCCCCTCAGTCTTGTGG + Exonic
1006986213 6:38177354-38177376 GGAGGCACCCTGAAGGCTTGCGG - Intronic
1015936135 6:138407490-138407512 CAGGGCCACTTGAAGCCTTGGGG - Intronic
1022399886 7:30027007-30027029 CGGGGCCCTATGAAATCTTCGGG + Intergenic
1030104828 7:105978316-105978338 AGGGGCTCTCTGAAGTCCTGTGG + Intronic
1032476376 7:132214154-132214176 GGGGTCCCCCTGAAGTCCAGGGG + Intronic
1034503460 7:151467340-151467362 CGGGGGGCCCTGAAGTTCTGGGG - Intronic
1034646933 7:152656053-152656075 CGGGGCCTGCTGAAGGCATGAGG + Intronic
1034954665 7:155327071-155327093 TGGGGCTCCCTGAGGTCTCGAGG - Intergenic
1034954683 7:155327140-155327162 TGGGGTTCCCTGCAGTCTTGTGG - Intergenic
1037669695 8:21003702-21003724 GGGGGCCCCCAAAAGTTTTGTGG - Intergenic
1042807681 8:72789647-72789669 CAGGGTCCCCTGATGTCTTGAGG - Intronic
1047611119 8:126521820-126521842 CTGGGCCCCTGGAAGTCTGGTGG - Intergenic
1049494249 8:142922357-142922379 CGGGTCCCCCTGGAGTCTCCAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1058264549 9:102882580-102882602 TGGGGCTCACTCAAGTCTTGTGG + Intergenic
1059785544 9:117578755-117578777 CAGGGCTCCCTGGAGCCTTGAGG + Intergenic
1061009855 9:127948470-127948492 CAGGGCCCCCTGCAGCCTTTCGG + Intronic
1061669340 9:132179908-132179930 AGGGGTCCCCTGACCTCTTGGGG + Intronic
1189299405 X:39941832-39941854 CTGGGCCCCCTGTAGGCTTTGGG - Intergenic
1190269377 X:48850924-48850946 CGGGGCTACCTGAAGCCTTGGGG + Intergenic
1193085981 X:77448097-77448119 CAGGGCCCCCTGATGTCGAGAGG - Intronic
1195947243 X:110228315-110228337 CAAGGCCCCCTAAAGTCATGGGG + Intronic
1200181650 X:154154589-154154611 CTGGGCCGCATGAAGTCTTCAGG - Exonic
1200187298 X:154191703-154191725 CTGGGCCGCATGAAGTCTTCAGG - Intergenic
1200192947 X:154228843-154228865 CTGGGCCGCATGAAGTCTTCAGG - Exonic
1200198702 X:154266647-154266669 CTGGGCCGCATGAAGTCTTCAGG - Exonic