ID: 1153611130

View in Genome Browser
Species Human (GRCh38)
Location 18:6886304-6886326
Sequence AAGAAAATACAGAGGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1013
Summary {0: 1, 1: 1, 2: 5, 3: 101, 4: 905}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153611125_1153611130 -4 Left 1153611125 18:6886285-6886307 CCACCAAGACACCATTTTGAAGA 0: 1
1: 0
2: 2
3: 23
4: 212
Right 1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG 0: 1
1: 1
2: 5
3: 101
4: 905
1153611123_1153611130 -2 Left 1153611123 18:6886283-6886305 CCCCACCAAGACACCATTTTGAA 0: 1
1: 0
2: 1
3: 34
4: 419
Right 1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG 0: 1
1: 1
2: 5
3: 101
4: 905
1153611122_1153611130 7 Left 1153611122 18:6886274-6886296 CCAAGAACTCCCCACCAAGACAC 0: 1
1: 0
2: 0
3: 24
4: 196
Right 1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG 0: 1
1: 1
2: 5
3: 101
4: 905
1153611121_1153611130 10 Left 1153611121 18:6886271-6886293 CCTCCAAGAACTCCCCACCAAGA 0: 1
1: 0
2: 4
3: 15
4: 155
Right 1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG 0: 1
1: 1
2: 5
3: 101
4: 905
1153611126_1153611130 -7 Left 1153611126 18:6886288-6886310 CCAAGACACCATTTTGAAGAAAA 0: 1
1: 1
2: 4
3: 43
4: 475
Right 1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG 0: 1
1: 1
2: 5
3: 101
4: 905
1153611124_1153611130 -3 Left 1153611124 18:6886284-6886306 CCCACCAAGACACCATTTTGAAG 0: 1
1: 0
2: 1
3: 13
4: 226
Right 1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG 0: 1
1: 1
2: 5
3: 101
4: 905
1153611120_1153611130 27 Left 1153611120 18:6886254-6886276 CCAGAACATAATGCTTTCCTCCA 0: 1
1: 0
2: 1
3: 25
4: 200
Right 1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG 0: 1
1: 1
2: 5
3: 101
4: 905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153611130 Original CRISPR AAGAAAATACAGAGGGACAA AGG Intronic
900077848 1:832535-832557 AAGAAAAAAAAGAGGGAGGAAGG - Intergenic
901302386 1:8209188-8209210 AATGAAATCCAGTGGGACAAAGG - Intergenic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
903301750 1:22384107-22384129 AACAGAAGACAGAGGGACACAGG - Intergenic
903560050 1:24220349-24220371 AAGAAAATAAAGTGAGATAAAGG - Intergenic
903636883 1:24825436-24825458 AAGAAAATGGAGAGGGTAAAGGG + Intronic
903829835 1:26168210-26168232 AAGAAAAGACTTAGGGACCATGG - Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
905110793 1:35593009-35593031 AAGAAAAGACAGAGAGAGGAGGG + Intronic
905663131 1:39743872-39743894 AAGAGAATAAAGAGGAAGAAGGG + Exonic
905872960 1:41415521-41415543 AAAACAGAACAGAGGGACAAGGG + Intergenic
906181304 1:43822013-43822035 AAGAAAATAGAGCAAGACAAGGG + Intronic
906767892 1:48452216-48452238 AAGAAAAGAAAGACGGAAAAAGG + Intronic
906882319 1:49605233-49605255 AAGAGAATAAACAAGGACAAAGG + Intronic
906922556 1:50079921-50079943 AACAAAAGAGAGAGGGAGAAGGG - Intronic
907356619 1:53880334-53880356 AATAAAATACCTAGGAACAAGGG + Intronic
907387000 1:54132479-54132501 AAGAAAAGAAAGAGAGACAAAGG + Intergenic
907922404 1:58925779-58925801 AAAAAAAAAAAGAGGGACAAGGG + Intergenic
908021114 1:59900238-59900260 AATGAGATAGAGAGGGACAAGGG - Intronic
908022479 1:59912596-59912618 ATGAAAAAACTGAGGAACAAGGG + Intronic
908201086 1:61796752-61796774 AAGAAAATAGAAAGGAAGAAAGG - Intronic
908227665 1:62072255-62072277 CAGAAAATACTGGGGGATAAAGG - Intronic
908410090 1:63855495-63855517 AATAAGATACAGAGGGAAAAAGG - Intronic
908635344 1:66157623-66157645 AGGAAAATAAAGAGGGTTAAGGG - Intronic
909266478 1:73565064-73565086 AATAAAATACATAGAGAGAAGGG + Intergenic
909658234 1:78054536-78054558 AAGAAAATACAGAGAATGAATGG - Intronic
909864871 1:80654595-80654617 AAGACAATACAGAAGGGGAATGG - Intergenic
910313103 1:85850026-85850048 AAGGAAATACAGAGAGAAAAAGG + Intronic
910434005 1:87187044-87187066 AAGAAAGGAGAGAGGGAGAAAGG - Intergenic
910615477 1:89193181-89193203 AAGAAAAGACAGAGTGCAAAAGG - Intronic
910687158 1:89929151-89929173 AAGTAAATACAGTGTGATAAGGG + Intronic
910884764 1:91952788-91952810 AAAAAAAAAAAGAGGGACCAAGG + Intronic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911117346 1:94259542-94259564 AAGAGAAAACAGAGACACAAGGG + Intronic
911393504 1:97275955-97275977 AAGAAAAAAAAGAGGTCCAATGG - Intronic
911461994 1:98202886-98202908 AAGAAAAGACACAGGGAAAGGGG + Intergenic
911552439 1:99299909-99299931 AATAAATTGCAGAGGGATAAGGG + Intronic
911797100 1:102089257-102089279 AAGAAAACCCAGAAGGAAAATGG - Intergenic
912080254 1:105927418-105927440 AAGAAAATAAAGTGAGATAAAGG + Intergenic
912231731 1:107801075-107801097 AAGAACATACAGTGGGCAAAAGG - Intronic
912563954 1:110571727-110571749 AACATAATGCAGAGGGACAGAGG - Intergenic
912928661 1:113936099-113936121 AAGAAAATACAGAATCACAATGG - Intronic
913495451 1:119424146-119424168 AAGAAAATATATAGGGACCTAGG + Intergenic
913514434 1:119591176-119591198 AAGAAAGAACAGAGGAGCAAAGG + Intergenic
914751875 1:150540181-150540203 AAGAAAAGAAAGAGGGAGAAGGG + Intergenic
915009167 1:152668681-152668703 CAGAAAGGACAGAGGGACATGGG - Intergenic
915418259 1:155758988-155759010 AACAAAAAAGAGAGAGACAATGG - Intronic
915492169 1:156256896-156256918 AAGAAAATGTAGAAAGACAAAGG - Intronic
915811169 1:158912648-158912670 AAAAAAATAAAAAGAGACAAAGG + Intergenic
916339019 1:163707725-163707747 AAGAACATACAGTGGGGGAAAGG - Intergenic
916401542 1:164453945-164453967 AAGAAAAGAAAGAGGGGGAAGGG + Intergenic
916697693 1:167256253-167256275 AAGAGAAGAGAGAGGGAAAAGGG + Intronic
916986277 1:170195035-170195057 AAAAAAATACAAAGGGTCAATGG - Intergenic
916997418 1:170315658-170315680 AAAAAAATAAAGAGGAACAGAGG - Intergenic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
918036615 1:180879657-180879679 AAGAAAATAAAGCAGGACAAGGG - Intronic
918058520 1:181043234-181043256 AAAGCAATACAGAGGGACATTGG + Intronic
918354211 1:183690778-183690800 AAGAAAAATCAGTGGGAGAATGG - Intronic
919190899 1:194217248-194217270 AAGAAAAGAAAGAGAGACATTGG + Intergenic
919469371 1:197959293-197959315 AAGAAAATAAAAAAGGACATAGG - Intergenic
919745589 1:201006453-201006475 AAGAAAATGCTGTGGGACTAAGG + Intronic
920025810 1:202994681-202994703 AAGAAATCACAGAGGGAAATTGG + Intergenic
920143404 1:203837443-203837465 AAAAAAAAAAAGAGAGACAAGGG - Intronic
920692559 1:208158212-208158234 AAAAACAGACAGAGGGACACAGG - Intronic
921171218 1:212551538-212551560 GAGAAAAGAAAGAGTGACAATGG - Intergenic
921713701 1:218397594-218397616 AAAGAAATACAGAAAGACAAAGG - Intronic
922165908 1:223115697-223115719 AAGAAAGTAAAGTGGGAAAAAGG + Intronic
922331125 1:224576949-224576971 AAAAACATAAAGTGGGACAAAGG + Intronic
922567767 1:226612061-226612083 AAGGAAACACAGGGAGACAAGGG + Intergenic
923192607 1:231634345-231634367 AAGTAAATACAGAGATAAAACGG + Intronic
923406020 1:233661391-233661413 AAGCAAAGACAGAGAGGCAATGG - Intronic
924096571 1:240557714-240557736 AACAAAAAAGAGAAGGACAAGGG + Intronic
924135532 1:240962402-240962424 AAGAATATAGAGAGAAACAAAGG - Intronic
1062920198 10:1273646-1273668 AAGAAGATGCAGGGGGACAGAGG + Intronic
1063352336 10:5367069-5367091 AAGTAAATATAGAGGTAAAAGGG + Intronic
1063474349 10:6315464-6315486 AAGAAAATACTCGGGGACAGAGG - Intergenic
1063597258 10:7447194-7447216 AATAAAAAACAAATGGACAAAGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1065087571 10:22194755-22194777 AAGAAAAGAAAGAAAGACAAAGG + Intergenic
1065837070 10:29668246-29668268 AAGAAAAAACAGAGGAATATGGG + Intronic
1066155920 10:32677800-32677822 AAGAAGAAAGAGAGGGAAAATGG - Intronic
1066434632 10:35385991-35386013 AAAAAAAAACAGAAAGACAAAGG - Intronic
1066436576 10:35401553-35401575 AAAAAAATTCAGAGGGAGAAAGG - Intronic
1066596188 10:37052567-37052589 GAGAAAAAACAGAGGGAGAAAGG + Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1067501718 10:46811612-46811634 AAAAAAATACTGTGGGAAAAAGG - Intergenic
1067592862 10:47528394-47528416 AAAAAAATACTGTGGGAAAAAGG + Intronic
1067639978 10:48036497-48036519 AAAAAAATACTGTGGGAAAAAGG + Intergenic
1068156961 10:53212299-53212321 AAAAAAATCAAGAGGGAGAAAGG - Intergenic
1068386751 10:56339068-56339090 CAGAAAATACTTAGAGACAAAGG - Intergenic
1068714233 10:60169882-60169904 AAACTAATACAGAGGCACAATGG - Intronic
1068775327 10:60862639-60862661 AAGAAAAAAGAAAGGGAGAAAGG - Intergenic
1069119239 10:64548160-64548182 ATGAAAATACCAAGGGAGAAGGG - Intergenic
1069332152 10:67305386-67305408 AAAAAAAGAGAGAGAGACAATGG + Intronic
1069692004 10:70359889-70359911 AAAAAAATGCAGTGGAACAACGG - Intronic
1070900209 10:80022118-80022140 CAGAAAACACTGAGGGTCAATGG + Intergenic
1070901963 10:80037988-80038010 CAGAAAACACTGAGGGTCAATGG + Intergenic
1071034658 10:81230607-81230629 AAAAAAAAACAAAGGGACAGAGG - Intergenic
1072110570 10:92316088-92316110 AAGAAGATACAGAGAGGGAAAGG + Intronic
1072391853 10:94995190-94995212 AAAAAAATTCAGAAGGAAAAAGG - Intergenic
1073346844 10:102789678-102789700 ATGAAACTGCAGAGTGACAAAGG - Intronic
1074247338 10:111708162-111708184 AATAAAAAAAAGAGGGAAAATGG - Intergenic
1074709740 10:116167334-116167356 GAGAAAATACGGAGGGGCAAAGG - Intronic
1074713512 10:116197713-116197735 AAGAAATTAAACAGGGACATGGG + Intronic
1076249884 10:128977437-128977459 AAGAAAATACAGCAGGCCTAGGG - Intergenic
1076943168 10:133623356-133623378 AGGGAAAGACAGAGGGAGAAAGG - Intergenic
1077437168 11:2548347-2548369 AAGAAAATACAGCAGAACATGGG + Intronic
1077571627 11:3344247-3344269 AAGAAAATACAAATTCACAATGG + Intronic
1077827181 11:5823785-5823807 AGGAAAAAACAGAGGGAGACAGG - Intronic
1077965066 11:7121554-7121576 AAGAAAATGAAAAGTGACAACGG + Intergenic
1078074015 11:8140805-8140827 AAGAAAATACAGACTAACAGCGG + Intronic
1078758868 11:14235751-14235773 AAGAAAAGATAGTGGGATAAAGG + Intronic
1079149269 11:17883223-17883245 TAGAAAATACAGCTGGACCAGGG + Intronic
1079950729 11:26800494-26800516 TAGAAATTACAGAGGAACATAGG - Intergenic
1080229587 11:30004373-30004395 AAAAAAATACAGAAAGATAATGG + Intergenic
1080251954 11:30243645-30243667 TAGCAAATTCACAGGGACAATGG - Intergenic
1080939445 11:36898831-36898853 AAGAAGATACAGAGAGAAAAGGG + Intergenic
1082128568 11:48459835-48459857 GGGAAAATACATAAGGACAAGGG - Intergenic
1083010416 11:59391980-59392002 AAGAAAATACTGAGTGGCACAGG + Intergenic
1083049682 11:59766049-59766071 AAGAAATAACAGAGGGGAAAGGG - Intronic
1083601839 11:63953611-63953633 AAGAAAAGACACAGAGACTAAGG - Intronic
1085126464 11:74005781-74005803 CAGAAAATACAGCGGGACTATGG - Exonic
1085381077 11:76119305-76119327 AAGAGAGTACAGAGAGAAAAAGG - Intronic
1085404472 11:76253873-76253895 AAGAGAAGACAGAGAGACACAGG - Intergenic
1085447037 11:76607805-76607827 AAGAAAATAAAGTGATACAAGGG - Intergenic
1085700865 11:78745197-78745219 AAAAAAAGAAAGAGGGACAGTGG - Intronic
1085797090 11:79551967-79551989 AAGAAAAGAGAGAGGAAAAATGG - Intergenic
1086087094 11:82966489-82966511 AAGAAAAAACTGAGGCACAGAGG + Intronic
1086218953 11:84418566-84418588 AAGAAAATACAGTGCAATAATGG - Intronic
1086274121 11:85104892-85104914 AAAAAAAAACAGAGAGAGAAAGG + Intronic
1086324773 11:85687073-85687095 AAGAAAATCCAGTGGAAGAAGGG - Intergenic
1086353448 11:85966892-85966914 TAGAAAATTCAGAGGGAGCATGG + Intronic
1086379338 11:86236000-86236022 AGGAAAAGACAGAGAGAGAAAGG + Intergenic
1086483115 11:87266754-87266776 AAGAAAGGATAGAGGGTCAAAGG + Intronic
1086534172 11:87823841-87823863 AAGAATATACAGAGTGAAAGAGG + Intergenic
1086641789 11:89167873-89167895 AAGAAAATAGAGAGGAAAAAAGG - Intergenic
1086987396 11:93265556-93265578 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1087002109 11:93431628-93431650 AATAAATTATAGAGGGGCAAGGG + Intronic
1087095577 11:94314350-94314372 AGGAAAATAAAGAGAGAAAAAGG + Intergenic
1087416750 11:97866433-97866455 AAAAAAATACAGAATGAAAAAGG - Intergenic
1087657455 11:100941625-100941647 GAGAAAGAACAGAGGGACAGCGG - Intronic
1087852138 11:103044604-103044626 AAGAAAAGCCAGCGGGACTAAGG - Intergenic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1088014616 11:105043844-105043866 AAGAAAATGCATGGGGGCAACGG + Intronic
1088074939 11:105836481-105836503 AAGAATATACAGAGGGCAGATGG - Intronic
1088107956 11:106227049-106227071 AAGAAAACACATAAGGAAAATGG + Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088677793 11:112213062-112213084 AAGAAACTAGAGAGTAACAAAGG - Intronic
1088876272 11:113939252-113939274 GGGAAAAGACATAGGGACAAGGG - Intronic
1089095243 11:115914851-115914873 AAGAGAATAAAGACTGACAAGGG + Intergenic
1089115016 11:116087846-116087868 AAGAAAGGAGAGAGGGAGAAGGG - Intergenic
1089955885 11:122570547-122570569 AAGAACATACAAAGGCACAAAGG - Intergenic
1090058050 11:123440063-123440085 AGGAAAATACAGAAAGGCAATGG + Intergenic
1090128714 11:124117140-124117162 AAGAAAATACTGAGGCTCAGAGG + Intronic
1090646752 11:128772682-128772704 AGGGAAAGAAAGAGGGACAAGGG + Intronic
1091064672 11:132498308-132498330 AAGAAAAAACAGATGACCAATGG - Intronic
1091147908 11:133296576-133296598 ACAAAAGCACAGAGGGACAATGG - Intronic
1091618865 12:2070854-2070876 AAGAAAATAAAGAAAGAAAAAGG - Intronic
1091691488 12:2600392-2600414 AAGCAAACACAGAGGGAAATGGG - Intronic
1091940212 12:4472652-4472674 AGGAAAATACAGAGTTACAGAGG + Intergenic
1091991065 12:4956204-4956226 AAAAATATGCAGAGGAACAATGG + Intergenic
1092195529 12:6547685-6547707 AAGAAAGGACAGAAAGACAAGGG + Intronic
1092512159 12:9168513-9168535 AAAAACATAAAGAAGGACAAAGG - Intronic
1092563024 12:9636699-9636721 AAGAAAAAAAAGTGGGAAAAAGG + Intergenic
1092625714 12:10326083-10326105 AAAAACATACAAAGGGTCAATGG - Intergenic
1092672658 12:10881920-10881942 AAGAAAATAGAGAGAGCCAAAGG + Intronic
1092976117 12:13746480-13746502 AAGAAGATACAGACGGAATATGG - Intronic
1093028257 12:14264391-14264413 AAAAACATCCAGAGGGAGAAAGG - Intergenic
1093281322 12:17199853-17199875 AAGAAAATAATTAGGAACAAAGG + Intergenic
1093508611 12:19899802-19899824 AAGATAATACAGAAGAAAAATGG - Intergenic
1093784914 12:23181772-23181794 AAGATATTACAGAGAGAGAAAGG - Intergenic
1094049839 12:26206907-26206929 ATGAAAATACAGAGGGAGAGTGG - Intronic
1094615120 12:32029466-32029488 AAGGAAAGAAAGAGGGAGAAAGG + Intergenic
1095093961 12:38134808-38134830 AAGCAGAGAAAGAGGGACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095195594 12:39312042-39312064 AAGAAATTCTAAAGGGACAATGG + Intronic
1095262728 12:40116033-40116055 AAGAAAATAAAGAGGAAAAGGGG + Intergenic
1095390982 12:41706138-41706160 AATAAAACACAGAGAGAAAAAGG - Intergenic
1095531144 12:43188322-43188344 AACAAAATACAGAGTGAAAATGG - Intergenic
1096356955 12:50949293-50949315 AAGAAGAAAAAGAAGGACAAAGG - Intergenic
1096419043 12:51440397-51440419 AAAAAAAAACAGAGAGAGAATGG - Intronic
1096621273 12:52867186-52867208 AAGAAAATGTGTAGGGACAAGGG + Intergenic
1096849467 12:54426488-54426510 AGGAAAAGACAGAGGGGCAAGGG + Intergenic
1097415678 12:59313368-59313390 AAGAAAAGAGAGAGAGAAAAGGG - Intergenic
1097644384 12:62218313-62218335 AAGAAAAAACAGTGGAAGAAAGG + Intronic
1097651208 12:62299054-62299076 AAGCAAATACATACAGACAAAGG - Intronic
1097661319 12:62434795-62434817 AAAAAAAAAGAGAGGGAAAACGG - Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098085766 12:66841246-66841268 AAGAAAAGAGAGAAGGAGAAAGG - Intergenic
1098420288 12:70289030-70289052 AAGAAAATAAAGCAGGGCAAGGG - Intronic
1098454291 12:70654618-70654640 AATAAAACAAAGAGGGACACAGG - Intronic
1099038985 12:77626962-77626984 AATAAAAGAAAAAGGGACAAAGG + Intergenic
1099147429 12:79064225-79064247 AAGAAAAGACTGAAGGAGAAAGG + Intronic
1099228630 12:79997695-79997717 AAGACAATAAAGAAGTACAATGG - Intergenic
1099517025 12:83609669-83609691 GAGAAAATTCATAGTGACAAAGG - Intergenic
1099803044 12:87481331-87481353 AAGAAAATAAAGTAGGGCAATGG + Intergenic
1100252198 12:92838441-92838463 AAAATCAAACAGAGGGACAAAGG + Intronic
1100475350 12:94930517-94930539 AACAGAATTCAGAGGGACCAAGG + Intronic
1100574712 12:95879863-95879885 TAGAAAATACAGTGGGGTAAAGG + Intronic
1100606194 12:96153964-96153986 AAAAAAAGAGAGAGAGACAAAGG + Intergenic
1100635327 12:96430049-96430071 AACAAAACACAGAGTGAAAAAGG - Intergenic
1100643717 12:96507364-96507386 AAGTAAATATAGATGGAGAAGGG + Intronic
1100678198 12:96891243-96891265 ATGAAAATCCAGAGGGCTAAAGG + Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101006374 12:100405071-100405093 AAGACTATACCGAGGGACACAGG + Intronic
1101063916 12:100999684-100999706 AAGAAAAGAGAGAGGGAGAGAGG + Intronic
1101289418 12:103352472-103352494 AAAATAATACAGAAGGAGAAAGG - Intronic
1101670343 12:106865706-106865728 AACAAAATGAAGAGGAACAAAGG - Intronic
1101836168 12:108296826-108296848 AAAAAAAAAAAGAGGGACACAGG + Intronic
1102194019 12:111011666-111011688 AAGAAAAGAGAGAGGAAGAAAGG + Intergenic
1102521879 12:113482696-113482718 AAGAAAATAGACAGGGAGGAGGG - Intergenic
1103404529 12:120666030-120666052 AAGAAAAGAGAGAGAGAGAAGGG + Intronic
1103633481 12:122282722-122282744 AGCAAGACACAGAGGGACAAAGG + Intronic
1103897473 12:124282913-124282935 GAGAAAATACAGAGTGACTGGGG + Intronic
1104111918 12:125712117-125712139 TAGAAAATCCAGAGGGAGAATGG + Intergenic
1106234871 13:27853254-27853276 AAGAAAAAACACAGATACAAGGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107921199 13:45210046-45210068 AAGAGACTACAGTGGGGCAAGGG - Intronic
1108011398 13:46016598-46016620 AAGAAAACACAAGGGGACTATGG + Intronic
1108021171 13:46129089-46129111 TATAAAACACAGAGGGAAAACGG + Intronic
1108045894 13:46384278-46384300 AAGTAAATACAGAGAGAATAGGG + Intronic
1108183593 13:47866331-47866353 AGGTAAATAAAGAGGGAGAAAGG - Intergenic
1108414047 13:50179462-50179484 AAGAAAAAGCAGAGCAACAATGG - Intronic
1108421895 13:50259220-50259242 AAGAAAAACCAGATGGAGAATGG - Intronic
1108487283 13:50939660-50939682 AAGATAATTCAGTGGGAAAAAGG + Intronic
1108867908 13:54943289-54943311 TAGAAAATACACAGGGAACAGGG - Intergenic
1108895120 13:55316853-55316875 AAAAAAGGACAAAGGGACAAGGG - Intergenic
1109261637 13:60151316-60151338 AAGGGAAAACAGAGGCACAAAGG + Intronic
1109305790 13:60640136-60640158 AATAAAATACATAAGGACCATGG - Intergenic
1109383149 13:61591760-61591782 AAAAAAATACATCGGAACAAAGG - Intergenic
1109591372 13:64488036-64488058 AAAAAAATAGAGAAAGACAAGGG + Intergenic
1109623071 13:64935445-64935467 AATAAAATACAGAGAGTGAAAGG - Intergenic
1109888600 13:68576790-68576812 AAGAAAATACAGTGAGACTAGGG + Intergenic
1109987166 13:70002806-70002828 AAGAAAAATCAGTGGGAGAATGG + Intronic
1110371766 13:74748309-74748331 AAGAAAAAAGAAAGGGACATGGG + Intergenic
1110575819 13:77053770-77053792 AAGAAAATACAGAGGATGAATGG - Intronic
1110775356 13:79403028-79403050 AGGAACATACAGAGGACCAAGGG - Intronic
1110983386 13:81932782-81932804 AAGAAAATAAAGAAAGAAAAAGG + Intergenic
1111079346 13:83281426-83281448 AAAAAGATAAAGAGGGAGAAAGG + Intergenic
1111280657 13:86018943-86018965 ATGAAATGACAGAGGGAGAAAGG + Intergenic
1111993925 13:95144295-95144317 TAGAAAATGCCCAGGGACAAAGG + Intronic
1112833067 13:103477456-103477478 AAGACATTTCAGAGGCACAAGGG + Intergenic
1112978573 13:105352569-105352591 AAGTATATATAGAGGGACATTGG - Intergenic
1113358814 13:109609653-109609675 AAGCAAATAGAGAGGGAGAGAGG + Intergenic
1113525345 13:110970405-110970427 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1113538473 13:111086639-111086661 AAGAAAAAAGAAAGGAACAATGG - Intergenic
1114145949 14:19978773-19978795 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1114172734 14:20289748-20289770 TAGAAAAGACAGACAGACAAAGG + Intronic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114536623 14:23427094-23427116 AAGAGAAGACAGAGTGAAAATGG + Intronic
1114739761 14:25083545-25083567 AAGAAAATAGAAAGGGACTCAGG + Intergenic
1115189182 14:30728829-30728851 AAAAAAAAAAAAAGGGACAAAGG - Intronic
1115791910 14:36889379-36889401 AAGAAATTACAGAAATACAAAGG + Intronic
1115891756 14:38038281-38038303 AAGAAAATACATACGATCAACGG + Intronic
1116215674 14:42014150-42014172 AAGATAAAAGAGATGGACAAGGG - Intergenic
1116505950 14:45681466-45681488 AAGAAATTAAAAAGGGAGAATGG - Intergenic
1116676403 14:47911500-47911522 AAGAGAATATAGAAAGACAAGGG - Intergenic
1116679924 14:47953998-47954020 AAAACCATTCAGAGGGACAAAGG + Intergenic
1116857266 14:49963760-49963782 AAAAAAAAAAAGAGGGACAGAGG + Intergenic
1117056746 14:51919973-51919995 CAACAGATACAGAGGGACAACGG - Intronic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117224979 14:53647282-53647304 AGAAAAATACAGAGGGAGGAAGG - Intergenic
1117507069 14:56414613-56414635 CAGAAAATAAAGTTGGACAAGGG + Intergenic
1117667003 14:58066606-58066628 AAAAAAATAAACAGGGAGAAGGG + Intronic
1117673541 14:58132572-58132594 AAAAAAAAAAAAAGGGACAAGGG - Intronic
1118395258 14:65330754-65330776 ATGAAAATTCAAAGGGAGAATGG + Intergenic
1119260727 14:73236856-73236878 AAGAAAAGAAAGAGGAAGAAAGG + Intergenic
1119432427 14:74577201-74577223 AAGAAAAGAAAGAGAGAGAAGGG + Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119654242 14:76405600-76405622 AGGAAAAGACAGAAGGAAAATGG + Intronic
1120027302 14:79600863-79600885 AAGAAAATGCAGAAAGAAAAAGG + Intronic
1120041730 14:79761231-79761253 AATACAATACAGAAGGCCAAAGG - Intronic
1120271011 14:82312818-82312840 AATAAAATACAGAGGTTCATTGG - Intergenic
1120299059 14:82682099-82682121 AAGAAACCACAGAGGGGCACAGG + Intergenic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1121148946 14:91612797-91612819 AAGGAAATACAGAGGTCTAATGG + Intronic
1121566098 14:94910334-94910356 AAGAAAAGAGAGAGAGAGAAAGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121990232 14:98550205-98550227 AACAAAAAACAGTGGCACAATGG + Intergenic
1122361560 14:101169978-101170000 AAGAAACTAGAGAGGGAGGAGGG + Intergenic
1122382641 14:101320415-101320437 AAGAGAATTCAGAAGGAAAATGG + Intergenic
1122481043 14:102047746-102047768 AAGAAATCACAGAGGGAAAAGGG - Intronic
1124191326 15:27579819-27579841 GAGAACATCCAGAGGGCCAAGGG - Intergenic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124501621 15:30232477-30232499 AAGGAAAGAAAGAGGGAGAAAGG - Intergenic
1124507946 15:30294911-30294933 AAGGAAAGACAGAGGCACATCGG + Intergenic
1124601634 15:31137429-31137451 AAGATAATTCAGAATGACAATGG + Intronic
1124601817 15:31139100-31139122 AAGATAATTCAGAATGACAATGG - Intronic
1124735609 15:32243746-32243768 AAGGAAAGACAGAGGCACATCGG - Intergenic
1124741944 15:32306186-32306208 AAGGAAAGAAAGAGGGAGAAAGG + Intergenic
1124898284 15:33798068-33798090 AATAAAAGACAGACAGACAAAGG - Intronic
1125039986 15:35174358-35174380 AAGCAAATTCAGAGAGAGAAAGG - Intergenic
1125400596 15:39298342-39298364 AAGAAAATAAGGAGGGAAATTGG + Intergenic
1125913504 15:43463433-43463455 AAGAAATAACAGATGAACAAGGG + Intronic
1126551357 15:49933763-49933785 AAGAAAAGAAACAAGGACAATGG - Intronic
1126558271 15:50015244-50015266 AAGAAAATGAAGAGGGAAATTGG + Intronic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127120839 15:55770800-55770822 AAGGAAATACAGAGGTAAAGAGG - Intergenic
1127453010 15:59134768-59134790 AAGAACATACAGAAGATCAAGGG - Exonic
1127624796 15:60769803-60769825 AAGAAATTGGAGGGGGACAATGG - Intronic
1128330568 15:66752944-66752966 GAGAAGGTACAGGGGGACAAGGG + Intronic
1128478254 15:68015802-68015824 AAAAAAAAACAGAGAGAAAAGGG - Intergenic
1128776594 15:70324964-70324986 AAGAAAGTACAAACGGAGAAGGG + Intergenic
1128818727 15:70633345-70633367 AACAAAACAGAGAGGGAGAAAGG + Intergenic
1129325858 15:74800019-74800041 GAGTGAATACAGAGGGACACGGG - Intronic
1129976982 15:79830874-79830896 AAGAAGAGACAGAAGGATAAAGG + Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130263367 15:82377064-82377086 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130277936 15:82492602-82492624 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130470266 15:84219787-84219809 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130477754 15:84334354-84334376 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130494011 15:84453776-84453798 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130592555 15:85224415-85224437 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1131378786 15:91947085-91947107 AAGGAAATACACAGGGCCAAAGG - Intronic
1131616995 15:94026767-94026789 AAGGAAATTCAGAGGAACAAGGG - Intergenic
1131696220 15:94880762-94880784 AAGAAAAGACAGAAGAAAAAAGG - Intergenic
1131775457 15:95792079-95792101 GAGAAAAGACAGAGGAAGAAAGG - Intergenic
1131949964 15:97671425-97671447 AAGAAAATACATATACACAATGG - Intergenic
1131973417 15:97916011-97916033 AAGAAAAAAAAGAGGTAGAAAGG - Intergenic
1132123442 15:99197923-99197945 AAGAAAAAAGAAAGGGACAGAGG + Intronic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132424685 15:101705202-101705224 AAGAAAATACTGGGAAACAAAGG - Intronic
1133168236 16:3964186-3964208 AGCAAAATGCACAGGGACAACGG + Exonic
1133330174 16:4967996-4968018 AATAAAATAGAGAGGGAGAAAGG - Intronic
1133392751 16:5422760-5422782 AAGAAGATGGAGAGGGAGAAGGG + Intergenic
1133866008 16:9644051-9644073 GAGAAAATAAAGAGGCACAGAGG + Intergenic
1134132349 16:11658308-11658330 AATAAAATAGAGAGAGAGAATGG + Intergenic
1134296767 16:12953058-12953080 GAAAAAATAAAGAAGGACAAAGG + Intronic
1134385770 16:13770846-13770868 AAGAAAATACAAAGGATCACAGG + Intergenic
1135263908 16:21005206-21005228 AAGGAAATACAGAAGGAGAGAGG - Intronic
1135331575 16:21564529-21564551 AAGAAAAGAGAGAGAGAGAAAGG + Intergenic
1135525767 16:23212664-23212686 AACAATACACTGAGGGACAAGGG - Exonic
1137356906 16:47775504-47775526 AAGAACATACATTGGGAGAAAGG + Intergenic
1137641260 16:50032329-50032351 AAGAATATGTAGAGGGACAAGGG - Intronic
1137657068 16:50169322-50169344 CAGAAAATACAGGGGAAAAAGGG - Intronic
1137658853 16:50185725-50185747 AAGAAAAGAGAGAGGGAGGAAGG - Intronic
1138005293 16:53329706-53329728 TAGAAAATCCAAAGGGACAGGGG + Intergenic
1138182661 16:54952756-54952778 AAGAAGATAGAGATGGAGAAAGG - Intergenic
1138396181 16:56706528-56706550 AAGAAAATAAAGAAAAACAAGGG - Intronic
1138885429 16:61072236-61072258 AGGAAAATAAACAGAGACAATGG - Intergenic
1139029654 16:62863716-62863738 AAGAAAATACCGAAGTTCAATGG + Intergenic
1139084792 16:63571678-63571700 AAGAGCCTCCAGAGGGACAATGG + Intergenic
1139377232 16:66507529-66507551 AAGAAAATACACAGATGCAAAGG - Intronic
1139715978 16:68813550-68813572 AAGAAGATACCAGGGGACAAGGG - Intronic
1139791844 16:69443882-69443904 AACAAAAAACAGAGGGTCAGTGG + Intronic
1139896529 16:70292143-70292165 AAAAAAAGAGAGAGAGACAAGGG - Intronic
1140121980 16:72091804-72091826 AATAAAATACTGAGGTACAAGGG + Intronic
1140176198 16:72663071-72663093 AACAAAAAACAGAGAGATAAAGG - Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141055985 16:80814920-80814942 AAAAAAAAAAAGAGGAACAATGG - Intergenic
1141274180 16:82570152-82570174 AAGAAATAACTGAGGGAAAAGGG + Intergenic
1141385878 16:83621899-83621921 AAGAAATGACGGAGGGACAGAGG - Intronic
1141411658 16:83838339-83838361 AAGAAAAGAGAAAGGGAAAAAGG + Intergenic
1141924875 16:87161506-87161528 AAGAAAAGAGAGAGAGAGAAAGG + Intronic
1142423109 16:89985184-89985206 AAGAAAAGAAAAAGAGACAAAGG + Intergenic
1142548029 17:719100-719122 AACAAAAAACAGAGAGACCAGGG - Intronic
1142689245 17:1595029-1595051 AAAAAAAGAGAGAGAGACAAGGG + Intronic
1143197600 17:5087941-5087963 AAGAAGATCTAGAGGGAAAATGG + Intronic
1143294580 17:5861170-5861192 AGGAAGGTCCAGAGGGACAAGGG - Intronic
1143339713 17:6201253-6201275 AGGAGAATAGAGAGAGACAAAGG - Intergenic
1143544106 17:7586441-7586463 AAAAAAAAAAAAAGGGACAAGGG + Intronic
1143662361 17:8333740-8333762 CAGAAAAAACTGAGGCACAAAGG - Intergenic
1144355323 17:14440064-14440086 AAGAAAAAAAGGAGGGAGAAAGG + Intergenic
1144435887 17:15240337-15240359 AAGAAAATACTGATGAAGAAAGG + Intronic
1144509366 17:15862170-15862192 AAGAAAAAAAAAAGGGAGAAGGG - Intergenic
1146202291 17:30869458-30869480 AAGAAAAAACGAAGGGAGAATGG - Intronic
1146252607 17:31362532-31362554 AAGGAAATAAAGAAGGAGAAGGG - Intronic
1146593915 17:34153489-34153511 AAAAAAAGACAGAGGGACAAAGG + Intronic
1146831668 17:36075054-36075076 AGGAAAATACAGAATGGCAAAGG - Intergenic
1146955921 17:36936356-36936378 AAGAAAGTACGGGGGGACAATGG + Intergenic
1147248387 17:39137731-39137753 AAGAGAAGACACAGGGTCAAGGG + Intronic
1147492187 17:40879987-40880009 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1148390008 17:47264869-47264891 AAGAAAATAAAGCAGGATAAAGG - Intronic
1149161066 17:53693799-53693821 AAGAGAATACAGAGTGAAAAAGG - Intergenic
1149239196 17:54629217-54629239 AAGAAAAAAAAGAGGGAGCAGGG - Intergenic
1149440650 17:56671177-56671199 AAGAAAAGAAAGAGAGAGAAAGG + Intergenic
1149532814 17:57408946-57408968 AAGAAAATAAAGAAAGAAAATGG - Intronic
1150540287 17:66089727-66089749 AAGAAGAAAAAGAGAGACAAAGG + Intronic
1151219657 17:72603115-72603137 AAGAAATGACCGAGGGAGAAGGG - Intergenic
1151439389 17:74118482-74118504 AAGAAAAAAGAGAGGGGCAGGGG - Intergenic
1151534269 17:74729858-74729880 AAGAAGATCTGGAGGGACAAAGG + Intronic
1151650365 17:75464562-75464584 GAAAAAATACACAGGGATAAGGG - Intronic
1152100331 17:78297868-78297890 AAGAAAGAAGAGAGGGACAGAGG - Intergenic
1153530524 18:6041502-6041524 AAGAAAAGACAGAGAAATAAGGG - Intronic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1153718971 18:7881869-7881891 AAGAAAATGAAGAGGGAAAGTGG - Intronic
1153723179 18:7928192-7928214 ATGAAAAAACAGAGTGACACTGG - Intronic
1153803463 18:8691740-8691762 AAAGAAATCCAGTGGGACAATGG + Intergenic
1153815332 18:8785812-8785834 AAGAAAACAAAAATGGACAAGGG - Intronic
1154111722 18:11574813-11574835 AAGAAAAGAGAGAGAGAGAAAGG + Intergenic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1154329507 18:13418146-13418168 AGGAAGCTACAGAGGGAGAAAGG - Intronic
1154466444 18:14646575-14646597 AAAAAAATACAAAGAGCCAATGG - Intergenic
1155196103 18:23476292-23476314 ATTAAAACACAGAGGGATAATGG - Intronic
1155349721 18:24894690-24894712 AGGAAAATGCACAGGGAGAAAGG + Intergenic
1155436507 18:25818205-25818227 AAAAAAAAAAAGAGTGACAAAGG - Intergenic
1155927906 18:31677730-31677752 AAACAGATTCAGAGGGACAAGGG + Intronic
1155958746 18:31976214-31976236 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1156154103 18:34281214-34281236 AAAAAATTTCAGAGGGAAAAAGG - Intergenic
1157619048 18:49004846-49004868 AAGATAATAAATAGTGACAAAGG - Intergenic
1157910548 18:51613986-51614008 ATGCAAATACAGAGGCACAGAGG - Intergenic
1157940187 18:51920090-51920112 AAATAAATACATGGGGACAAAGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158258729 18:55585536-55585558 AAGAAAGAACAGAGTGATAATGG - Intronic
1158281478 18:55833161-55833183 AAGACAAGAGAGAGAGACAAAGG - Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158493500 18:57931726-57931748 AAGAAAAGAAAGAGGGAGAAGGG - Intergenic
1158570891 18:58596285-58596307 AAGGAGATAGAGAGGGACACAGG - Intronic
1159156391 18:64588688-64588710 GAGAAATAACAGTGGGACAATGG + Intergenic
1159313107 18:66736051-66736073 AAGAAAAGAGAGAGAGAGAAAGG - Intergenic
1159438795 18:68451094-68451116 AAAAAAGAAAAGAGGGACAATGG - Intergenic
1159708923 18:71729513-71729535 AAATACATACAGAGGTACAATGG + Intergenic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1159964031 18:74579021-74579043 AAGACAATAAAGGGGGATAATGG - Intronic
1160281143 18:77492313-77492335 AAAAAAAGACAGGGGGAAAAAGG + Intergenic
1160610963 18:80084715-80084737 AAGACAAGCCAGAGGAACAAAGG + Intronic
1161176257 19:2844078-2844100 AAGAAAAGAGAGAGAGAGAAAGG - Intronic
1161185348 19:2914981-2915003 AAGAAAATAAAGGGGAATAAAGG + Intronic
1161524859 19:4747917-4747939 ATGAAAACACAGAGAGACAGAGG - Intergenic
1161829078 19:6589861-6589883 AAGAACAGAGAGAGGGACAGAGG - Intronic
1161863223 19:6814732-6814754 AAGACAAGACAGAGGGAAAAAGG - Intronic
1162248038 19:9419250-9419272 AAGAAAAGACAGAAGTAGAAAGG - Exonic
1162254241 19:9475317-9475339 AAGAAAAGACAGAGGCAGAAAGG - Exonic
1162271299 19:9618124-9618146 AAGAAAAGACAAAGGTAGAAAGG - Exonic
1162815453 19:13191511-13191533 AAGAAAATAAAGAGTCAGAAAGG - Intergenic
1163191379 19:15679244-15679266 AAGCAAATAAAGAGAGTCAAAGG + Intronic
1163373559 19:16915924-16915946 AAGAAAAGAGAGAGAGAAAAAGG - Intronic
1163564207 19:18040235-18040257 AAGAAAAGAAAGAGGAATAAAGG + Intergenic
1163976675 19:20859203-20859225 AAGAAAATAAAAAGGGAAATCGG + Intronic
1164179776 19:22807928-22807950 AAGAAAATACATAATTACAAAGG - Intergenic
1164260034 19:23561302-23561324 AAGAAAAGAAAGAAGGACAGAGG + Intronic
1164263648 19:23592919-23592941 AAGAACATAAAGTGGGAGAAAGG + Intronic
1164296252 19:23912684-23912706 AAGAAATTACACAGAGATAATGG + Intergenic
1165020857 19:32922859-32922881 AAGAAAAGAAACAGAGACAAGGG + Intronic
1166618052 19:44269215-44269237 AAGAAAAAAAAAAAGGACAATGG - Intronic
1167032141 19:46969823-46969845 AGGAAAATACAGAGGGCAGATGG - Intronic
1167206395 19:48105472-48105494 CAGAAAATTCACAGGGAAAAGGG + Intronic
1168319851 19:55502489-55502511 ACAAAAAGACAGAAGGACAAGGG - Intronic
1168403617 19:56099724-56099746 AAGAAAAGAGAGAGAGAGAAAGG + Intronic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925244493 2:2368731-2368753 AAGAAAAGAGAGAACGACAAAGG + Intergenic
925615396 2:5740493-5740515 AAGAAAAGCCAGAGGCAGAATGG - Intergenic
925887934 2:8409770-8409792 CAGAAAATCAACAGGGACAAAGG + Intergenic
926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG + Intergenic
926604170 2:14879965-14879987 TTGAAAATACAGAGGCATAAAGG + Intergenic
926653995 2:15379181-15379203 AAAAAAAGAGAGAGAGACAAGGG - Intronic
926863486 2:17334124-17334146 GGGAAAATACACAGGGACACAGG + Intergenic
926930277 2:18031039-18031061 AAGAACATACACAGGGAGAAAGG + Intronic
926956916 2:18311663-18311685 AAGTAAATACAGAGTGAAATGGG + Intronic
927272076 2:21222498-21222520 AGGAAAATAAAGCAGGACAAAGG + Intergenic
927417239 2:22892113-22892135 CAGAAAATACTTAGGAACAAGGG + Intergenic
927680060 2:25133079-25133101 AAGAAAATTAAGAGGGATAAAGG - Intronic
927754269 2:25696298-25696320 TAGAAAATGCATAGGGGCAAAGG + Intergenic
927852041 2:26505465-26505487 AAGAGACTACATAGGGCCAAAGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928490275 2:31776652-31776674 AAAAAAGTACAGTGGGAAAAGGG - Intergenic
928498610 2:31862984-31863006 AAGAAAGAAAAGAGGGAAAAAGG + Intergenic
928963651 2:36955367-36955389 AAGAAAATCGAGAGGGAGGAGGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929260905 2:39865651-39865673 AAGAAAAAACAAAGGGAAAGAGG + Intergenic
929536465 2:42787289-42787311 AAGCAAAGACAGAGGGAGACAGG + Intronic
929762584 2:44818299-44818321 AAGAAACCTCAGAGTGACAATGG - Intergenic
929926697 2:46218216-46218238 AGAAAAATATATAGGGACAATGG - Intergenic
930172399 2:48265109-48265131 AAAAAAATTTAGAGGCACAAGGG + Intergenic
930406478 2:50963326-50963348 AAGGAAATAAGGAGGGAAAAGGG - Intronic
930662182 2:54065117-54065139 AAATAAATATAGAGGGACCAAGG + Intronic
930969635 2:57379207-57379229 AAGAAATTAGAGAAGGGCAAGGG - Intergenic
932578606 2:72978036-72978058 AAGAAAATATAGATGAACACTGG - Intronic
933255211 2:80072777-80072799 AAGAAAATAGGGAGGGTCAAGGG + Intronic
933583489 2:84153887-84153909 AAAAAAATACAGAGGATGAAGGG + Intergenic
933855965 2:86414853-86414875 AAGACAACACAAAGGTACAAAGG + Intergenic
935066182 2:99650588-99650610 TAAAAAATACAGTGGGAGAAGGG + Intronic
935182317 2:100701949-100701971 AAGAAAATACTGACAGACGATGG - Intergenic
935202874 2:100873591-100873613 GAGAAAATACAGAGGTTTAAAGG - Intronic
935476708 2:103531309-103531331 CAGGAAATACAGGGGAACAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935829416 2:106985099-106985121 AAAAAAATAGAGAGAGAGAAAGG + Intergenic
935833887 2:107029088-107029110 AAGAAAATACATAAGACCAAGGG - Intergenic
936696413 2:114954722-114954744 AAAAAAATATAGAGAGAGAAAGG + Intronic
936768427 2:115882267-115882289 AAGAAAATACAGAAGGTTAAAGG + Intergenic
936941084 2:117884880-117884902 AAGAAAAGAAAGAGAGAGAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938580117 2:132638120-132638142 AAAAAGAGACAGAGGGAGAAAGG + Intronic
939470935 2:142618343-142618365 TAAAAAATAAAGATGGACAAAGG + Intergenic
939551671 2:143623576-143623598 AAGAGAATACTGAGTGAGAAAGG - Intronic
939683338 2:145166841-145166863 AAGAAAATGCACTGAGACAATGG + Intergenic
939944090 2:148387201-148387223 AAGAAAATACATCGTGACCACGG + Intronic
940302423 2:152189118-152189140 AAGAGAATACATAGGAATAAGGG + Intergenic
940352648 2:152706375-152706397 AAGAGAATTCAGAAGGAAAACGG + Intronic
940374215 2:152939226-152939248 AAGAAAAAACAGAGAGAAAAGGG - Intergenic
940536501 2:154952010-154952032 AAGGAAATACAGGAGGACAAGGG - Intergenic
940541618 2:155027758-155027780 AAGGAAAGAAAGAGGGAGAAAGG - Intergenic
940629413 2:156218834-156218856 AAGATAATAATGATGGACAAAGG + Intergenic
942627911 2:177923026-177923048 AGGAGAATGCAGAGAGACAATGG - Intronic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
943423774 2:187703089-187703111 AATAAATTACAGAGAAACAATGG + Intergenic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
944709628 2:202324097-202324119 ATGAAAAGACAGAGGGGCAAAGG + Intergenic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
945085053 2:206122637-206122659 AAAAAAAAACAAAGGGAAAAAGG + Intronic
945101892 2:206269904-206269926 AAGAAAAAAGAGAGAGAGAAAGG - Intergenic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945888365 2:215401283-215401305 AAGAAAAGAGAGAGAGAGAAAGG + Intronic
945897390 2:215499237-215499259 GAGAAAATAAAGAGATACAAAGG + Intergenic
946061010 2:216941650-216941672 AAGAGAATAAACAGAGACAAAGG - Intergenic
946169890 2:217888684-217888706 AAGAGAAGAGAGAGGGTCAAGGG - Intronic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
946943331 2:224793469-224793491 AAGAAAATAAAGAGGCTCAGGGG + Intronic
947766884 2:232643644-232643666 AAAAAAACACAGATGGACATTGG - Intronic
948025768 2:234775053-234775075 AATAAAATAAGGAGGGAGAAAGG + Intergenic
948873604 2:240816120-240816142 AAGAACAAAGACAGGGACAAGGG + Intronic
1168822939 20:788176-788198 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1169087065 20:2833565-2833587 AAGGAAAGGCAGAGTGACAAGGG + Intergenic
1169172893 20:3479859-3479881 GAGAAAAGACAGAGACACAAAGG - Intronic
1169535777 20:6538336-6538358 AAAAAAATAGAGAGAGAGAATGG - Intergenic
1169705682 20:8501589-8501611 TAGAAAATTCAGAAGGACCAGGG - Intronic
1169807637 20:9575792-9575814 AAGAAAATCCAGGGGCAGAAAGG - Intronic
1170189300 20:13628774-13628796 AAGAAAATAAAAATGGCCAAAGG + Intronic
1170286863 20:14719504-14719526 AAGAAAATAAAGAAAGAAAAAGG + Intronic
1170820275 20:19751708-19751730 AAGAGAAGAGAGAGGGACATGGG + Intergenic
1171152167 20:22836861-22836883 AAAAAAATGTAGAGGGACACAGG - Intergenic
1172057954 20:32167245-32167267 AAGACAAAACAGTAGGACAATGG - Exonic
1172179167 20:32990194-32990216 ATGAGAATACTGAGGCACAAAGG + Intronic
1172391973 20:34571690-34571712 AGAAAAAGACAGTGGGACAAGGG + Intronic
1172480814 20:35270350-35270372 AAGGCATTCCAGAGGGACAACGG + Intronic
1172608691 20:36233111-36233133 AAGGAAATACACCGGGAGAAGGG + Intergenic
1172816350 20:37690179-37690201 AAGAAGATACAGTGGGAGAATGG - Intergenic
1173251128 20:41364770-41364792 CAGGAACCACAGAGGGACAAGGG - Intronic
1174076282 20:47939684-47939706 AAGAAAGTACAGCGGGGCAGTGG + Intergenic
1174217917 20:48931557-48931579 AAGGAGATACAGGGTGACAAGGG + Intronic
1174335193 20:49854700-49854722 AGGAGAAAACCGAGGGACAACGG - Intronic
1174348234 20:49947731-49947753 AAGACAGAACAGAGGGCCAAAGG - Intronic
1174735883 20:52965348-52965370 AAGAAAATACAGAGAAAGAGTGG + Intergenic
1174742168 20:53025632-53025654 AAGAAAATACAGGTTGACACTGG - Intronic
1175403581 20:58713770-58713792 AAGAAAAAACACAGGCAGAAAGG - Intronic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1176650328 21:9540715-9540737 AAGAGAGTAAAGAAGGACAAAGG + Intergenic
1176675530 21:9773707-9773729 AAGAAAATAAAGGAGGAGAAGGG + Intergenic
1176808148 21:13512022-13512044 AAAAAAATACAAAGAGCCAATGG + Intergenic
1177441215 21:21128017-21128039 AAAAAAATACAAAGGGAAAATGG - Intronic
1177554899 21:22676558-22676580 GAGAAAATAGAGAGGGGGAAAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178731977 21:35112255-35112277 ATGAAAAGACTGAGGTACAAAGG + Intronic
1179476274 21:41648258-41648280 AGGAAAATACAGAGGGTCTGGGG - Intergenic
1179710299 21:43209512-43209534 AAGACTGTCCAGAGGGACAATGG + Intergenic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181542066 22:23578974-23578996 AAGAAAAAAAAGAGAGAAAAAGG + Intronic
1182801231 22:33033491-33033513 CAGAAAATACCGTGGGATAATGG - Intronic
1183539041 22:38419074-38419096 AAAAAATGACAGAGAGACAAGGG - Intergenic
1184024886 22:41848246-41848268 AAAAAAATACAGGGGGAGGAGGG - Intronic
1184064498 22:42109743-42109765 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1184472823 22:44705312-44705334 AAAAAAATAGAGAGAGAGAAAGG - Intronic
1185107137 22:48879303-48879325 AAGACAAGAAAGAGAGACAATGG - Intergenic
949110017 3:248606-248628 AAACAAAAACAGAGGGACAGAGG - Intronic
949508058 3:4745053-4745075 AAGAAAACACAGAAAGAGAAAGG - Intronic
949756921 3:7422763-7422785 AATAAAACACAGAAGAACAATGG - Intronic
950078715 3:10206087-10206109 AAGAAAATGCAGAGGGAGCTGGG + Intronic
950256089 3:11507318-11507340 AATAAAACACAGAGTTACAAAGG + Intronic
950433355 3:12964466-12964488 AAGAAAATCCAGCGGGTCATTGG + Intronic
950961112 3:17109042-17109064 AAGAAAATACAACAGGAGAATGG + Intergenic
951101708 3:18695537-18695559 AAGAAAATATAGAGGACAAATGG - Intergenic
951588044 3:24235266-24235288 AAGGAAACACAAGGGGACAAAGG - Intronic
952063669 3:29541617-29541639 AAGAAAAAGAAGAGGGGCAAGGG - Intronic
952377352 3:32778905-32778927 AAGGAAGTACAGAGGGAGACTGG - Intergenic
952429544 3:33209455-33209477 AATAAATAACAGAGGGAAAAAGG - Intronic
952762471 3:36926794-36926816 GACAGAATACAGAGGAACAAGGG + Intronic
952781994 3:37110001-37110023 AAGAAAACACTGAGGGAAAGAGG + Intronic
953011160 3:39026767-39026789 AAGAAGATACTGAGGGAGAGGGG + Intergenic
953213311 3:40895532-40895554 CAGAAAATACAGAGAGAGAATGG - Intergenic
953892109 3:46759005-46759027 AAGCAAATACAGAATGAAAAAGG + Intronic
953900535 3:46839115-46839137 ATGAAAATTGAGAGGGAAAATGG + Intergenic
954495851 3:50960765-50960787 AAGAAAATATAGAGTGACCTTGG - Intronic
954813773 3:53264592-53264614 GAGAAAATATAGGGGGAAAATGG - Intergenic
954953814 3:54500552-54500574 AAGAAAAGAAAGAGAGAGAAAGG - Intronic
955163046 3:56484005-56484027 AAGAAAAGAAAGAGAGAAAAAGG + Intergenic
955388280 3:58497957-58497979 AAGAAAAGAAAAAGGGAGAAGGG - Exonic
955970122 3:64430630-64430652 AACAGAATACACAGGGAGAATGG + Intronic
956003914 3:64759076-64759098 AAGCAAAGAAAGAGGTACAAGGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956372468 3:68578340-68578362 AAGGAAATAGAGAAAGACAAAGG - Intergenic
956414154 3:69009941-69009963 AAAAAAAAACAAAGGGTCAAGGG + Intronic
956462061 3:69482487-69482509 AAGAAAAGAGAGAGGGGGAATGG + Intronic
956530567 3:70213125-70213147 AACAAAATAAAGAGAGACAGAGG - Intergenic
956629667 3:71303783-71303805 AAGAAAATAAAAACGGAAAAAGG + Intronic
956780184 3:72597470-72597492 AAGAAAATAAAACAGGACAATGG + Intergenic
957160762 3:76606725-76606747 AAAAAAATAGAGACAGACAAAGG + Intronic
957266122 3:77968560-77968582 AATAAAATACGTAGGAACAAAGG - Intergenic
957397498 3:79661042-79661064 AAGTAGATAGAGAGGCACAAAGG + Intronic
957419896 3:79954121-79954143 AAGAAAAGATAGAAGGATAATGG - Intergenic
957507801 3:81146989-81147011 AAGCAAATACAGAGAGAGAATGG - Intergenic
957755824 3:84485930-84485952 AAGAACATACAATGGGAAAAAGG - Intergenic
958184481 3:90102874-90102896 AAGAAAATGCAAATGGACAGAGG + Intergenic
958704753 3:97641386-97641408 AATAAAATACAGAGGAAGAATGG + Intronic
958773447 3:98453769-98453791 AAGAGAAGAAAGAGGGAAAATGG - Intergenic
959100054 3:102000176-102000198 AAGAAAACACAGTGGAACCAGGG + Intergenic
959101524 3:102015579-102015601 AAGTAAATCCAGAGGTAAAATGG + Intergenic
959231349 3:103656297-103656319 AAGAAAAAACAGATGTACAGAGG + Intergenic
959714390 3:109416925-109416947 AAAAAAAAACAGAGAGAGAAAGG - Intergenic
960066811 3:113383124-113383146 AAGAAAAGACAGAGGGATAAAGG + Intronic
960568636 3:119163294-119163316 AAGAAAATCCATAGGGACATAGG + Intronic
960649326 3:119928625-119928647 AAAAAAAAAAAGAGGGAAAAGGG + Intronic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
962454650 3:135553946-135553968 AAGAAAAAACAGAGAGACACAGG - Intergenic
963198193 3:142557629-142557651 ATGAAATCATAGAGGGACAAAGG + Intronic
963208534 3:142662321-142662343 GAGAACATACAGAGTGAGAATGG - Intronic
963440879 3:145337785-145337807 AAGAAAATAAAAAGAGAGAAAGG - Intergenic
963912329 3:150825448-150825470 AAGAACATTCAGAGGGCCATAGG + Intergenic
964100924 3:152987714-152987736 ATGAAAATACATAGAGAAAAAGG + Intergenic
964619009 3:158702004-158702026 AAACAAATGCAGAGGGAGAATGG - Intronic
965318457 3:167221400-167221422 AAGAACATACATGGGGAAAAGGG + Intergenic
965323116 3:167271490-167271512 AAGAAAACTCAGAAGGAAAATGG + Intronic
965401953 3:168223066-168223088 AAGAAAATTCAGAGGAAAAAAGG + Intergenic
965636384 3:170785639-170785661 AAGAAGAAAGAGAGAGACAACGG + Intronic
965747560 3:171941006-171941028 AAGAAAAAAGAGAGGAAAAAAGG - Intergenic
966182843 3:177202749-177202771 AATAAAATAAAGTGGGATAATGG + Intergenic
966599694 3:181762813-181762835 AAGAAAAAAAAGAGAGACAAGGG - Intergenic
966641906 3:182201396-182201418 AAGAAAATAAGGAGGGAATAGGG - Intergenic
966772420 3:183515818-183515840 AAGAAGAGAAAGAGGGACAGAGG + Intronic
966834235 3:184037026-184037048 AAAAAAAAAAAGAGTGACAAAGG - Intronic
967432985 3:189409977-189409999 AAGAAAATACAGATAGAAATAGG - Intergenic
967473622 3:189890772-189890794 AAGAAACTGCAGAGGGAGGAGGG - Exonic
967530184 3:190540304-190540326 AGAAAAAAACAGAAGGACAAAGG - Intronic
967864482 3:194179133-194179155 AAGAAAATACAGCAGGGGAAGGG + Intergenic
968791270 4:2664534-2664556 AAGAAAATAGAGAGAGAGAAAGG - Intronic
968932834 4:3591484-3591506 CAGAAAAGACAGGGGGACAGAGG - Intergenic
970077098 4:12235170-12235192 AAGAACATTCAGTGGGAGAAAGG - Intergenic
970306708 4:14740087-14740109 AAGAAAATAGAGTGGGGTAAAGG - Intergenic
971037918 4:22715275-22715297 AAGAAGACACAGAGACACAAGGG + Intergenic
971077213 4:23164167-23164189 AAGAAAAGAGGGAGGGAGAAAGG - Intergenic
971850699 4:31982979-31983001 ATGAAACTACAGAGGGCAAAGGG - Intergenic
972158297 4:36192407-36192429 AAGAACAAACAGAGGGAAAGAGG + Intronic
972377099 4:38482559-38482581 AAAAAAAAACAGTGGGAGAAAGG + Intergenic
972850167 4:43039136-43039158 CAGAAAATATAGAGAGAGAAAGG - Intergenic
973125555 4:46579756-46579778 AAGAAGATACAGAGAGATACAGG + Intergenic
973175581 4:47201168-47201190 AAAAAAATATTGAGGAACAAGGG + Intronic
973284227 4:48397366-48397388 AAGGAAATACAGAAGGAAAGAGG + Intronic
974512458 4:62861915-62861937 AAAAAAATAAACAGGAACAATGG - Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974883260 4:67785334-67785356 ATGAGAAGACAGAGGGTCAAAGG - Intergenic
975032495 4:69638513-69638535 AAGAAAATAATGAAGGACAAAGG + Intronic
975248752 4:72152246-72152268 CAAAAAATACACAGGGAAAATGG - Intergenic
975698243 4:77035942-77035964 AGGAAAATGCAGAGGGGCAGTGG - Exonic
975974156 4:80075751-80075773 AGGAAGATACTGAGGGGCAAGGG + Intronic
976066919 4:81198313-81198335 AAGAAAAGACAGAGGCACAAAGG + Intronic
976122327 4:81796770-81796792 AAGAAAATACAATGGGAAAAAGG + Intronic
976393186 4:84526777-84526799 AGAAAAATAAAGAGGGAAAAGGG + Intergenic
976789825 4:88865865-88865887 AAAAAAAAAGAGAGAGACAAAGG - Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977181722 4:93883223-93883245 AAGAATATACAGACTGAAAAAGG - Intergenic
977402187 4:96546785-96546807 AAGAAAATACAGAGTTTAAAAGG + Intergenic
977609421 4:99016935-99016957 AAGAAAATACAGAAGGGAGATGG - Intronic
978227478 4:106354800-106354822 AAGAAATGACAAAAGGACAAAGG + Intergenic
978673813 4:111285034-111285056 AAATAAATACACAGGGAAAAGGG - Intergenic
979089742 4:116467225-116467247 AAAAAAATACAGAGGAACAGAGG - Intergenic
979201897 4:117988427-117988449 AAGAAAATAAATAAGGAAAACGG + Intergenic
979754553 4:124324850-124324872 AAGAGTCTGCAGAGGGACAAAGG + Intergenic
979879244 4:125933659-125933681 AAAAAAATACAAAAGGTCAAAGG + Intergenic
979892394 4:126115089-126115111 AAGAACATACACTGGGAAAAGGG - Intergenic
979916245 4:126437654-126437676 AAGAAGAAACAGAGTGAAAAGGG - Intergenic
980157997 4:129129901-129129923 AAGGAAATACAGATGGACTTAGG + Intergenic
981046107 4:140266801-140266823 AAGAAAATAAAAAGGGAGGAAGG + Intronic
981599144 4:146465978-146466000 TAGAAAATACAGAAGGAAAGAGG - Intronic
982425222 4:155250421-155250443 AAGAGAAAAGAAAGGGACAAGGG - Intergenic
982509112 4:156258443-156258465 AATAAAATACATAGGGACAAAGG - Intergenic
982952011 4:161710683-161710705 AATAAAAGGCAGAGGAACAATGG - Intronic
982999480 4:162395717-162395739 AAGAACATACACTGGGGCAAGGG + Intergenic
983376799 4:166940049-166940071 AATAAAATACATGGGGAAAATGG + Intronic
983876686 4:172884879-172884901 AAGAACATACAGTGGGGAAAAGG - Intronic
983982758 4:174019031-174019053 AAGAAATGACAGAGGAACAAAGG - Intergenic
984096928 4:175445935-175445957 AAGAACTTACAGAGTGATAAGGG - Intergenic
984202419 4:176741947-176741969 AACAAAAAACAGAGGAACTAGGG - Intronic
984476758 4:180244871-180244893 AAGAAAAGAAAGAAGGAAAAAGG - Intergenic
985087753 4:186331091-186331113 AATAAAAAACAGAGAGATAAAGG - Intergenic
985375884 4:189338390-189338412 AACAAAATAGAAAGGAACAAAGG - Intergenic
985400013 4:189584990-189585012 AAGAAAATAAAGGAGGAGAAGGG - Intergenic
986108155 5:4680770-4680792 ATTAAAATACAGAGGGATGAAGG + Intergenic
986388012 5:7256906-7256928 ATTAAAATACAGAGAGAAAATGG - Intergenic
986872534 5:12067089-12067111 TACAAAATATAGAGGCACAAAGG + Intergenic
986936567 5:12895589-12895611 AAGAAAATAAATATGGACAGAGG + Intergenic
987559443 5:19500171-19500193 ATGAAAATACAGTGGAATAAGGG - Intronic
987586326 5:19861548-19861570 TTGAGAATAAAGAGGGACAAAGG + Intronic
987766941 5:22244589-22244611 AAGGAAAGACAGAGAGAGAAAGG + Intronic
988276658 5:29089681-29089703 AAGAAAATGCTGAGGGAAAGAGG - Intergenic
988352519 5:30129881-30129903 AAGAAAACACAATGGGAAAAAGG - Intergenic
988693388 5:33595100-33595122 AAGAAAAGAGGGAGGGAAAAAGG - Intronic
988721154 5:33880617-33880639 ATGAGAAAACAGAGGCACAAAGG + Intronic
988820452 5:34879356-34879378 TAGAAAATACACAGAAACAATGG - Intronic
988919935 5:35931460-35931482 AATAAAATACAGAGGCCCCAAGG + Intronic
989136767 5:38163574-38163596 AAGAAAATACAGAAGGGAGAGGG - Intergenic
989440138 5:41461651-41461673 AAGAAAATCAAGAGAGAGAAAGG + Intronic
989602007 5:43209100-43209122 AAATAAAAACAGAGGGAAAATGG + Intronic
990111319 5:52328733-52328755 AAGAAAATCCAGAGTGAGTAAGG + Intergenic
990275160 5:54187687-54187709 AGGAAAATAGAAAGGGAGAAGGG - Intronic
990344411 5:54857221-54857243 AAGAAAAGACAAAGGTAGAAAGG + Intergenic
990763967 5:59161758-59161780 AAGTAAATACAGGGGGAAAACGG - Intronic
990877597 5:60503524-60503546 AATAAAGGACAGAGGGATAAAGG - Intronic
991092918 5:62710140-62710162 AAGAAAAGAAAGAGGGAGGAAGG - Intergenic
992214580 5:74513754-74513776 AGAAAATGACAGAGGGACAAGGG + Intergenic
992373285 5:76167333-76167355 AGGAAAATACAGAGCTAAAAGGG - Intronic
992565507 5:77991846-77991868 AAGAAAATAAGGAGAGTCAAAGG + Intergenic
993304565 5:86259330-86259352 AACAAAATACAGAGGCAGAATGG + Intergenic
993337356 5:86677568-86677590 GAGAAAAAACAAAGGGAGAAAGG + Intergenic
994129033 5:96203409-96203431 TAGAAAATACAGGGTTACAAAGG + Intergenic
994579743 5:101625910-101625932 AAAAAGACACAGAGGGACACAGG - Intergenic
994898504 5:105738727-105738749 AACAAAACACACAGGGATAAAGG - Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
994958732 5:106569544-106569566 AGTAAAATACACAGGGACACGGG + Intergenic
995003766 5:107166179-107166201 GAAAAAATATAGAGGGATAAGGG + Intergenic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995383011 5:111556013-111556035 AAGAAAACATAGGGGGATAATGG - Intergenic
995553401 5:113302308-113302330 AATAAAATGCAAAGGGAAAAAGG + Intronic
995846175 5:116496129-116496151 AAGCAATTACTGAGGGAAAAAGG + Intronic
995906589 5:117131374-117131396 AATAAGATGCAGAGGGAAAATGG - Intergenic
996312384 5:122121495-122121517 AACAAAAGACAGAGTGAAAAAGG + Intergenic
996647199 5:125830256-125830278 ATGAAAATAGAAAGGGACAAGGG - Intergenic
997012929 5:129900894-129900916 AATAAACTGCAGTGGGACAAGGG - Intergenic
997029290 5:130105182-130105204 AAGAAAAAAGAAAGGGAGAAAGG - Intronic
997195659 5:131977523-131977545 AAGGAAACAGAGAGGAACAATGG - Intronic
997499964 5:134365795-134365817 AAGAGACTAAAGAAGGACAAAGG - Intronic
997860488 5:137411105-137411127 ATGAAAATACAGTGGGGAAAAGG + Intronic
997897929 5:137736368-137736390 AAGAGAATACAGAGAGAAATTGG + Intergenic
998254998 5:140578412-140578434 AAAAAGATACAAAGAGACAATGG + Intronic
998297848 5:140988683-140988705 AAGAAAATACAGAGCGTCTAGGG - Intronic
998990133 5:147806485-147806507 TAGAAAATAAAGTGGGTCAATGG - Intergenic
999077068 5:148806403-148806425 AAGAAAAGACACAAGGAAAATGG + Intergenic
1000266966 5:159647200-159647222 AGGAATATACTGTGGGACAAGGG + Intergenic
1000536493 5:162484851-162484873 AAGAAAATACAGTAGGGTAATGG - Intergenic
1000610831 5:163371963-163371985 AAAAAAATAAAGAGGGCCCATGG + Intergenic
1000899765 5:166898388-166898410 AATAAAATACATAGAGGCAAGGG + Intergenic
1001013399 5:168118771-168118793 AAGAGAAGACAGAAAGACAAAGG - Intronic
1002108487 5:176892253-176892275 AAGAAATTAGAGAGTGACCAGGG + Intronic
1002125284 5:177038836-177038858 AAGAAAAAAAAGAGGGTCAGAGG - Intronic
1002312920 5:178325477-178325499 AAAAAAAAAAAGAGGGAGAAAGG - Intronic
1002396639 5:178961381-178961403 AAGCTAATACAGAGTGAAAATGG - Intronic
1003154994 6:3585747-3585769 GAGGAAGTACAGAGGGACATGGG - Intergenic
1003256162 6:4476741-4476763 AAGAAAATTTAGAGGGAAGAAGG - Intergenic
1003456382 6:6286453-6286475 AAGAAAATACACTTGGAAAAGGG - Intronic
1004067248 6:12260687-12260709 CAGAAACTCCAGAGGGACAGGGG - Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004850908 6:19698542-19698564 AAAAAAAAAAAGAGGGAAAAAGG - Intergenic
1005784831 6:29233011-29233033 AAGACAAAACAGAGGGCCCAGGG + Intergenic
1005895087 6:30171164-30171186 AAGAAAATATTGTGGGACAGAGG - Intronic
1006210697 6:32392105-32392127 AAGAAAATACAGCTGCATAAGGG - Intergenic
1006307749 6:33234831-33234853 ATGAAAATACAGAGGGGAAGGGG + Intergenic
1006604742 6:35248154-35248176 AAGAGTCTACGGAGGGACAAAGG + Intronic
1006827202 6:36944344-36944366 AAGAAAATAAAGAAAGAAAAAGG + Intergenic
1006932126 6:37694881-37694903 GAGAAAACACAGAGAGAAAAGGG + Intronic
1007000354 6:38306241-38306263 CAGAAATTCCAGTGGGACAAGGG - Intronic
1007294574 6:40812204-40812226 AAGAAAGCAGAGAGGGACAGGGG + Intergenic
1007534691 6:42576022-42576044 AAGAAAAAACAGAAGGGAAAAGG - Intronic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1008896022 6:56556231-56556253 AAGAAAATGCACAGTGATAAAGG + Intronic
1009409880 6:63353877-63353899 AAGAATATACATTGGGAAAAGGG + Intergenic
1009443387 6:63709898-63709920 AAGAAAATGTAGAGAGAAAAAGG - Intronic
1009891616 6:69691042-69691064 AAGAAAAAACAAAGGTAGAAAGG - Intronic
1010304267 6:74299897-74299919 AGAAAAATACACAGGGAAAAAGG + Intergenic
1010386232 6:75284250-75284272 AAGAAAAAACAGAGAAACAGAGG + Intronic
1010704229 6:79088789-79088811 GAGAAAATAAAGAGTAACAAGGG + Intergenic
1010843465 6:80676613-80676635 ATGAAAAAACAGGGGGAAAAGGG + Intergenic
1011210573 6:84951870-84951892 AAGAAAATACATAAGCAAAATGG + Intergenic
1011255557 6:85417267-85417289 GAGAAAGAACAGAGGGAGAAGGG + Intergenic
1011355458 6:86468787-86468809 AAGAAAAGACAAAGAGAGAAAGG - Intergenic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1011709306 6:90035909-90035931 AAGAAAATACCCAAGGAGAAGGG + Intronic
1011936537 6:92785601-92785623 AAGGAAAGACAGAGAGAAAAAGG + Intergenic
1012140425 6:95620119-95620141 AAGAATATACTGAAGAACAAAGG + Intergenic
1013139317 6:107315717-107315739 AAGAAAATACAGCTTGCCAAGGG + Intronic
1013687182 6:112599206-112599228 AACAAAATGAAGAGGGACAAAGG + Intergenic
1013835483 6:114330229-114330251 AAGAAAATAAACATGGATAATGG + Intronic
1014014625 6:116516064-116516086 AAGAAAATACAGAGACACACAGG - Exonic
1014119715 6:117710496-117710518 AAGAAGATTCAGAGAAACAAAGG + Exonic
1014191177 6:118498606-118498628 AAAAAAATAGAGAGAGAGAAAGG + Intronic
1014605608 6:123470410-123470432 ATGAAATTACTGAGGGACAATGG + Intronic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1014865907 6:126529848-126529870 AAGGAAATAAAAAGAGACAAGGG + Intergenic
1014926354 6:127275790-127275812 GAGGAAATACAGAGCTACAAAGG + Intronic
1015124624 6:129739634-129739656 AAGAAAATACTGAATGAGAATGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015150031 6:130026908-130026930 AAGAAAATTAAGAGAGACAATGG + Intronic
1015423707 6:133039990-133040012 GAGAACATCCAGAGAGACAATGG + Intergenic
1015526047 6:134175889-134175911 AAGGAAAGAAAGAGGGAAAAGGG + Intronic
1015725786 6:136297981-136298003 TAGAAAATACAGAAGAGCAAAGG - Intergenic
1016019684 6:139223464-139223486 AATAAAATAGAGAAGAACAAAGG + Intergenic
1016317377 6:142805490-142805512 AAGAGGACACAGAGAGACAAAGG + Intronic
1016654144 6:146498344-146498366 AAGAAAAATGTGAGGGACAAGGG + Intergenic
1016898052 6:149073503-149073525 AAGAAATAAAAGAGGGAAAATGG + Intronic
1016940055 6:149475875-149475897 TAGAAAAGAGAGAGGGACCAAGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017451448 6:154558027-154558049 AAAAAAGTACAAAGGGTCAAAGG + Intergenic
1017537695 6:155365965-155365987 AAGAAAATAACAAGGAACAAAGG - Intergenic
1017744418 6:157434129-157434151 AAGAAAATAGAGAAGAAAAACGG + Intronic
1018031099 6:159842722-159842744 AAAAAAAAAAAGAGGAACAAAGG - Intergenic
1018467686 6:164066215-164066237 TAAAAAATACACAGGGACATTGG - Intergenic
1018613978 6:165668734-165668756 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1018622083 6:165739370-165739392 AAGAACATACAATGGGAGAACGG + Intronic
1018651747 6:165998290-165998312 AAGAAAAGAAAGAGAGAGAAAGG + Intergenic
1019106651 6:169673203-169673225 AACAAAATACAGAGGGAAAATGG + Intronic
1020055082 7:5112173-5112195 AAGAAAATAGAAAGATACAATGG - Intergenic
1020123868 7:5521533-5521555 AGGAATATTCCGAGGGACAATGG - Intergenic
1020258746 7:6518292-6518314 AAGAAAACAAAAATGGACAAAGG + Intronic
1020744935 7:12068785-12068807 AGGAAAATACACAGGGCCTAAGG + Intergenic
1020978200 7:15033949-15033971 AAGAAGGTAAAGAGGGACTAGGG + Intergenic
1021345380 7:19521039-19521061 AAGGAAATAAAGATGGGCAAAGG + Intergenic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1022492693 7:30832843-30832865 AAGAAAGTTAAGAGGGAGAAAGG - Intronic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1022817210 7:33925018-33925040 GAGAAAATCAAGCGGGACAAGGG - Intronic
1023370386 7:39507227-39507249 AAGAAAAGAGAAAGGGAGAAAGG + Intergenic
1023471661 7:40529014-40529036 AACAAAACAGAGAGGAACAATGG + Intronic
1023737471 7:43247808-43247830 AAGAAAAGAAAGAGAGAGAAAGG + Intronic
1024195668 7:47056657-47056679 AAGCAAATAAAAAGGGACAGGGG - Intergenic
1024571853 7:50729761-50729783 AAGCAAATAAAATGGGACAACGG - Intronic
1025103954 7:56155682-56155704 AAAAAAAAAAAGAGAGACAAGGG + Intergenic
1026364355 7:69632608-69632630 AAGAAAACAGAGAGGGAAGAGGG - Intronic
1026744988 7:73004842-73004864 AAAAAAAAACATAGAGACAAGGG + Intergenic
1027031094 7:74889510-74889532 AAAAAAAAACATAGAGACAAGGG + Intergenic
1027098752 7:75360238-75360260 AAAAAAAAACATAGAGACAAGGG - Intergenic
1027459227 7:78431600-78431622 AAGAAAATGCAGATGGTAAATGG + Intronic
1027573842 7:79906838-79906860 AAGAAAAAAAAAAGGAACAAAGG + Intergenic
1027622351 7:80505034-80505056 AAGAATTTACAGAGGGATCAGGG + Intronic
1027743691 7:82045652-82045674 ATGAAATAACGGAGGGACAAAGG - Intronic
1028018222 7:85741076-85741098 AAGAAAATTCACAAGGAAAATGG - Intergenic
1028238427 7:88389078-88389100 AAAAAAATGCAGTGGGACAGAGG - Intergenic
1028406495 7:90480788-90480810 AACAAAATAAAAAGGGAGAAGGG - Intronic
1028443905 7:90896059-90896081 AAGAAAAAAAAGAGAGAGAAGGG - Intronic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1028759914 7:94484209-94484231 AGGAAAAGAGAGAGGAACAAGGG - Intergenic
1028920643 7:96306739-96306761 AACAAAATGCAGAGGGATGAAGG - Intronic
1028921647 7:96316379-96316401 AAGCATATACAGAGTGACAAAGG + Intronic
1028980737 7:96965266-96965288 AATAGAATACAGAGGGGGAAAGG - Intergenic
1029032804 7:97486604-97486626 AAGAAAAGACAGGGGGACTAAGG - Intergenic
1029399849 7:100337042-100337064 AAAAAAAAACATAGAGACAAGGG - Intronic
1029575263 7:101399350-101399372 AAGAAAGAAGAGAGAGACAAAGG - Intronic
1030014930 7:105209553-105209575 AAGAAAATAGAAAAGGAAAAAGG + Intronic
1030318899 7:108144088-108144110 TAGAAAAGACAGAAGGCCAAAGG + Intergenic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1030942453 7:115670977-115670999 AAGAGAAGATAGAGGGACAGGGG + Intergenic
1030976185 7:116126424-116126446 AAGAAAATAAAGAGGGCAAAGGG + Intronic
1031180114 7:118403281-118403303 AAAAAAAAACAGTGGCACAAGGG - Intergenic
1031334419 7:120510005-120510027 AAGAAATGACAGGGGGAAAAGGG - Intronic
1031832669 7:126646461-126646483 AGGAAATTACAGAGGGATGAAGG - Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032645330 7:133817663-133817685 AAGAAAATAAATAGGCACTAGGG + Intronic
1033097691 7:138445164-138445186 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1034091242 7:148365207-148365229 AAGAAAATAAAGCAGGAGAAGGG - Intronic
1034682049 7:152936335-152936357 AAGAAAAAAGAGTTGGACAAGGG - Intergenic
1034883197 7:154778088-154778110 ACAAAAACACAGAGGAACAAAGG - Intronic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1035414800 7:158673861-158673883 CACAACATCCAGAGGGACAAGGG + Intronic
1035968878 8:4225523-4225545 AAGAAAAAATAGAGGCAAAAAGG - Intronic
1036081633 8:5562810-5562832 AAGGAAATACAGGGAGAGAAAGG + Intergenic
1036104572 8:5826003-5826025 AAGAGAATTCAGAAGGAAAATGG - Intergenic
1036400739 8:8405563-8405585 AGGAAAGGACACAGGGACAAAGG - Intergenic
1036446162 8:8823022-8823044 AAGGAGAGACAGAGGGACACAGG + Intronic
1037282133 8:17253318-17253340 AAGAAAAGGCAGAGGGAAAAAGG - Intronic
1038634286 8:29272876-29272898 AAAAAAATAAAGAGGACCAAAGG + Intergenic
1038846793 8:31237539-31237561 AAAAAAAGAAAGATGGACAAAGG - Intergenic
1039766023 8:40629043-40629065 AAGAAAATAAAGAGGGCGAAGGG - Intronic
1039805617 8:40994977-40994999 AAAAAAAGACAGAGGGAGGAAGG + Intergenic
1040478117 8:47798802-47798824 AAAAAAAAAGAGAGAGACAATGG - Intronic
1040826712 8:51629468-51629490 AAGAAAAGAGAGAGAGAAAAAGG + Intronic
1041626388 8:60033683-60033705 AAGAAAAGACAGAGAGATAGTGG + Intergenic
1041766061 8:61419447-61419469 AAGAAAATAATGAGGGAAAATGG + Intronic
1042298422 8:67248370-67248392 AAGAACATACATTGGGAGAAAGG + Intronic
1042543085 8:69926734-69926756 AAGAAAATACAGAGAAAACATGG + Intergenic
1042634513 8:70858738-70858760 AAGAACATACAGTGGGGGAAAGG + Intergenic
1042731846 8:71943764-71943786 AATCACATACAGAGGAACAAAGG - Intronic
1042760212 8:72264225-72264247 GAGAAAAAACAGAGAGAAAAAGG - Intergenic
1042884230 8:73530405-73530427 AAGAACACACAAAGGAACAAAGG + Intronic
1043961998 8:86427167-86427189 AAAAAAAAAAAGAGGGAGAAAGG + Intronic
1044022192 8:87118332-87118354 AAAAAAATAGAGCGGTACAACGG + Intronic
1044065608 8:87695997-87696019 AAGAAAAGACAGGAGCACAAAGG - Intergenic
1045123867 8:99068087-99068109 AAGAAGATAAAGAGGCTCAAGGG - Intronic
1045235220 8:100346727-100346749 AAGAAATTTCAGAGAGAGAATGG + Intronic
1045269992 8:100653473-100653495 AAGGAAATACAGAGACACAGAGG + Intronic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045486133 8:102633176-102633198 AAGAAGACACAGAGAGACACAGG + Intergenic
1045535920 8:103027774-103027796 AAGAACATAGGGAGGCACAAGGG - Intronic
1045704112 8:104900187-104900209 AAGAGAAGAAAGAGGGATAAAGG - Intronic
1045958352 8:107936448-107936470 AAGAAAAAACAGAATAACAATGG - Intronic
1046108639 8:109694831-109694853 AAGGAAATACAGAGAGAGAAAGG - Intergenic
1046522414 8:115342349-115342371 AAGAAAATAAAAGGGGAAAATGG - Intergenic
1046665365 8:116996335-116996357 AATAAAATAAAGACAGACAATGG - Intronic
1046676588 8:117115446-117115468 AAGAAATTGCAGGGGGACCAAGG - Intronic
1046866478 8:119156489-119156511 AACAAAATCCAGGGGGACAATGG - Intergenic
1046885059 8:119357348-119357370 AAGAAAAGACAGATGGAAGAAGG - Intergenic
1047266330 8:123312837-123312859 GAGAAAATACAGAGTGTAAATGG + Intergenic
1047935558 8:129774283-129774305 AAGAAAAGACAGTGAGATAAAGG + Intronic
1048268432 8:133008292-133008314 GATAAAATACAGAGTGACTATGG + Intronic
1048700322 8:137081087-137081109 AATAAAATATTGAGTGACAAAGG - Intergenic
1050116583 9:2269710-2269732 AAGAAAATAAAGTGGGATAAAGG + Intergenic
1050116971 9:2273350-2273372 AAGAAAAAAAAGCAGGACAATGG - Intergenic
1050275113 9:3988962-3988984 ATGAAAATACAGAGAGACTGGGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050575316 9:6988901-6988923 AGGAAAATAAAGAAGGACAAAGG - Intronic
1050579105 9:7032082-7032104 AAGTAAATACAGAGTTACAGGGG - Intronic
1050966372 9:11809296-11809318 AAAAAAATTCACAGGGACAAAGG - Intergenic
1051092434 9:13425411-13425433 AAGAAAAGAAAGAGAGAGAAAGG - Intergenic
1051132731 9:13880818-13880840 AAGAAAGCAAAGAGGGGCAAGGG - Intergenic
1051157508 9:14167031-14167053 GAGAAAATATGGAGGAACAAGGG - Intronic
1051955992 9:22694006-22694028 AACAAAATACAGAATTACAAAGG + Intergenic
1052118935 9:24684568-24684590 GAGAAAATACAGAGGCAAAGTGG - Intergenic
1052246648 9:26344289-26344311 AAGAAAATCAAGAGGAAGAAAGG + Intergenic
1052302643 9:26971486-26971508 AAGAAAACACAGAAGGAAAATGG - Intronic
1052661166 9:31434047-31434069 AAGACAAGACAGTTGGACAATGG - Intergenic
1052691071 9:31817590-31817612 AAGAATATACAGAGTTAGAATGG - Intergenic
1052787997 9:32847718-32847740 ATGAAAATACAGAGGCTCAAAGG + Intergenic
1053321578 9:37103443-37103465 AAAAAAAAAAAGAGGGACAAAGG + Intergenic
1053620862 9:39814446-39814468 AAGAACATAAAGATGTACAAGGG - Intergenic
1053884231 9:42629888-42629910 AAGAACATAAAGATGTACAAGGG + Intergenic
1053888437 9:42664406-42664428 AAGAACATAAAGATGTACAAGGG - Intergenic
1054223251 9:62437334-62437356 AAGAACATAAAGATGTACAAGGG + Intergenic
1054227459 9:62471853-62471875 AAGAACATAAAGATGTACAAGGG - Intergenic
1054263300 9:62892996-62893018 AAGAACATAAAGATGTACAAGGG + Intergenic
1054457294 9:65440411-65440433 CAGAAAAGACAGGGGGACAGAGG + Intergenic
1054743632 9:68833193-68833215 AAGAAAATAAAGATAGGCAAAGG + Intronic
1054858801 9:69928843-69928865 AAGAAAACTCAGAAGGAAAATGG - Intergenic
1054899890 9:70357752-70357774 AAAAAAAGAGAGAGGGACAAAGG + Intergenic
1055104196 9:72495581-72495603 AATCTAAAACAGAGGGACAATGG - Intergenic
1055259567 9:74417265-74417287 AAGTAAATATGCAGGGACAAGGG - Intergenic
1055787203 9:79883811-79883833 AAGAGAATGGAGAGGGAGAAGGG + Intergenic
1055889351 9:81106374-81106396 AAGGAACTACAGAGGTACAGAGG + Intergenic
1056014622 9:82370709-82370731 AAGGAACTCCAGAGGGTCAAGGG + Intergenic
1056065664 9:82931763-82931785 AAGAAAAAACAGGTGGACATGGG - Intergenic
1056297722 9:85209237-85209259 AAGAAAGAACAGAGGAACCATGG + Intergenic
1056445249 9:86659418-86659440 AAGAAAAAACAGTGGTACAATGG + Intergenic
1056549829 9:87643063-87643085 AAGAAAATATAGAGAGAGAAAGG + Intronic
1056855462 9:90124845-90124867 GAGGAAATAAAGAGGTACAAGGG + Intergenic
1056953015 9:91060282-91060304 AATAAAATACTGAGGAAAAAAGG + Intergenic
1057404377 9:94755631-94755653 AAGAAGATAAAGAAGGTCAAAGG + Intronic
1057590543 9:96369571-96369593 AAGATAATCCAATGGGACAATGG + Intronic
1057815858 9:98294012-98294034 TAGAGAACACAGAGGGATAATGG - Intronic
1058168164 9:101644855-101644877 AATAAAAAATAGAGGGAAAAGGG - Intronic
1058587927 9:106530608-106530630 AAAAAAATCCACAGGGTCAATGG - Intergenic
1058625749 9:106931266-106931288 AATAAAAGTCAGAGGGAAAAGGG - Intronic
1058637682 9:107052347-107052369 ATGAAGAAACAGAGGCACAATGG + Intergenic
1059477693 9:114561076-114561098 AAGAAACTAAAGTGGGAAAAAGG - Intergenic
1059973717 9:119694016-119694038 AATGAAATCCATAGGGACAATGG - Intergenic
1060008249 9:120019528-120019550 AAAATAATACAGAGAGACAGAGG + Intergenic
1060336370 9:122727028-122727050 AAAAAAAAAAAGAGGGAAAAGGG - Intergenic
1060692311 9:125674040-125674062 AAGAAAATATTGCAGGACAACGG + Intronic
1060784660 9:126441154-126441176 GAGTAAATACAGAGGAAAAAGGG - Intronic
1061181065 9:129025588-129025610 AAGAAAGGAGAGAGGGACTAAGG + Intronic
1061492645 9:130954575-130954597 AGGAAAATACTGAGGCACAGGGG - Intergenic
1061650442 9:132044099-132044121 AAAAAGTCACAGAGGGACAAAGG + Intronic
1061730067 9:132606797-132606819 AAGAAACCAGAGAGGGGCAAGGG + Intronic
1061940737 9:133882536-133882558 GAGAAAAGACATAGGGAGAAAGG + Intronic
1062742634 9:138187527-138187549 AACTAAAAACAGAGGGAAAAAGG - Intergenic
1203628068 Un_KI270750v1:44269-44291 AAGAGAGTAAAGAAGGACAAAGG + Intergenic
1185556788 X:1027969-1027991 AAGAAAAGACAGAGAAAGAAAGG - Intergenic
1185686713 X:1934841-1934863 AAGAAAAGAAAGAGAGAGAAAGG + Intergenic
1185814788 X:3144741-3144763 AAGAAAGTAAGGAGAGACAAGGG - Intergenic
1186114045 X:6286549-6286571 AAGAAAATAAATAGGAACAAGGG - Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186189115 X:7052014-7052036 AAGAAAATGCAGAGGGACAAAGG - Intronic
1186240325 X:7558555-7558577 AAGAAAATACATGGGGAATATGG - Intergenic
1186275487 X:7934049-7934071 AAGAAAATACAGTGAGCTAAAGG - Intergenic
1186420813 X:9424594-9424616 AAGATAACTCAGAGGGAAAAAGG + Intergenic
1186494634 X:10002423-10002445 AAGAAAAGAGAGAGGGAGGAAGG + Intergenic
1186911096 X:14167257-14167279 AATAAAATACAGACTGAAAATGG - Intergenic
1187019645 X:15367189-15367211 AGGAAAATACAGAATGACATGGG + Intronic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1188019935 X:25146120-25146142 AACAAAATGTAAAGGGACAATGG - Intergenic
1188197112 X:27249960-27249982 AATAAAGTACAGTGGTACAAAGG - Intergenic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1188250017 X:27881827-27881849 AAGAAAATACTGCAGGAAAAAGG - Intergenic
1188450205 X:30301125-30301147 AAGAAAAGAGAGAGAGAGAAAGG + Intergenic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1188735812 X:33713999-33714021 AAAAAAATACAGAGAAAGAAAGG + Intergenic
1188882846 X:35511254-35511276 CGGATAATACAAAGGGACAAAGG + Intergenic
1188993842 X:36857939-36857961 AAGAGAAGAGAGAGGGACATAGG + Intergenic
1189387921 X:40552425-40552447 AAGAAAATTAAGAGAGACTAGGG + Intergenic
1189564106 X:42221767-42221789 ATGAAAAAACTGAGGGCCAAAGG + Intergenic
1189727690 X:43985115-43985137 AAGAAAATCCAAAAGGATAAGGG + Intergenic
1189752128 X:44233017-44233039 AAGAAAAAACAGAGAAAAAATGG + Intronic
1189924056 X:45934333-45934355 AAAAAAAAAAAGAGGGCCAAAGG - Intergenic
1189937110 X:46080916-46080938 TGGAAAGTACAGAGGGACAAGGG - Intergenic
1190050225 X:47144287-47144309 ACGAAGATACCGAGAGACAAAGG + Intronic
1190366945 X:49704061-49704083 AATAAACTGCAGAAGGACAAAGG - Intergenic
1190840202 X:54136827-54136849 AAAAAAATACAATGGGATAAGGG + Intronic
1191733239 X:64361062-64361084 AACAAAATACAGAATGAAAAAGG + Intronic
1191744416 X:64470361-64470383 TAGAAAAGACAGAGTGAGAAGGG + Intergenic
1191803733 X:65110364-65110386 AAGAAAATACATAGGATCTAGGG - Intergenic
1192231993 X:69271796-69271818 AAGAAAATAACTAGGGCCAAAGG - Intergenic
1192832980 X:74769491-74769513 AAGAAACTACAGAGAAATAAAGG + Intronic
1192868055 X:75156694-75156716 AAGAATATGCATAGGGAAAATGG - Intronic
1193892476 X:87067582-87067604 AATAAAATGCAAAGGGGCAAGGG - Intergenic
1194241675 X:91457117-91457139 GGGAAAATCCAGCGGGACAAAGG + Intergenic
1194319620 X:92428444-92428466 AAGGAAATAAAGAGGGACACCGG - Intronic
1194748765 X:97660328-97660350 AAGAAAATAATGAGGGATAATGG + Intergenic
1194776375 X:97969963-97969985 AAGAGACTGCAGAGAGACAAGGG - Intergenic
1194798551 X:98241735-98241757 AGTAAAATACACAGGGACAGAGG + Intergenic
1194842923 X:98766746-98766768 AAGAAAATACCAAGGGACTGTGG + Intergenic
1195781184 X:108466590-108466612 AAAAAAATACTGATGGTCAAAGG - Intronic
1195887157 X:109650710-109650732 AAGAAGGTATAGAGAGACAAAGG - Intronic
1196070852 X:111520060-111520082 AAAAAAAGAGAGAGAGACAAAGG + Intergenic
1196087990 X:111707119-111707141 AAGAAAATACTAAGTGCCAAAGG - Intronic
1196167680 X:112553355-112553377 AAGAAAATGCAAAGGCACCAAGG - Intergenic
1198638100 X:138722781-138722803 AAGAAACTACAGAGTGGGAAAGG - Intronic
1198649464 X:138845835-138845857 AAGTAAGTACAGAGGGGAAATGG + Intronic
1199138652 X:144284394-144284416 AAGAAAAGCCAGGGGCACAATGG - Intergenic
1199500978 X:148505065-148505087 AAGAGACCACAGAGGGAAAACGG - Intronic
1199730988 X:150632014-150632036 AAGAAAAAGAAGAGGAACAAGGG - Intronic
1199909003 X:152264687-152264709 AAAAAAATACAGTGGGTGAATGG + Intronic
1200274873 X:154722601-154722623 AAGAAAAGAAAAAGGGACAGAGG + Intronic
1200494414 Y:3864592-3864614 AAAAAAAAACAGGGGGAGAAAGG - Intergenic
1200627746 Y:5541525-5541547 AAGGAAATAAAGAGGGACACCGG - Intronic