ID: 1153613076

View in Genome Browser
Species Human (GRCh38)
Location 18:6907679-6907701
Sequence GTGGCTATAAAGAGGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153613076 Original CRISPR GTGGCTATAAAGAGGCAACA GGG Intronic
901821197 1:11830638-11830660 GTGGTTACAGAGAAGCAACAAGG - Intronic
904105039 1:28073055-28073077 TTGACTATAAAGAGGCACAAGGG + Intronic
904800805 1:33092011-33092033 GTGGTTGTAAGGAGGCACCAGGG - Intronic
905790329 1:40786043-40786065 GTGGCTATAAAGAGGCCCGTTGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907884242 1:58578083-58578105 CTGGCTATAAAGAGACAAACAGG + Intergenic
909540962 1:76791002-76791024 GTGGATTTGAAGAGGCAAGAGGG + Intergenic
910316271 1:85887181-85887203 CTGACTTTAAAGAGGGAACAAGG - Intronic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920875950 1:209836000-209836022 ATGGTTATAAAAGGGCAACAAGG - Intronic
921320529 1:213934209-213934231 GAGGGGATAAAGAGGCAGCAGGG - Intergenic
921564634 1:216701786-216701808 GAGGCTATTAAGAAGCAACATGG + Intronic
922346869 1:224703630-224703652 GAGGCTTGAAAGAGGCAACCAGG - Intronic
1064692273 10:17930474-17930496 GTGGCTATAATGGTGCAGCATGG + Intergenic
1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG + Intergenic
1068746576 10:60538472-60538494 TAGGCTTTTAAGAGGCAACATGG - Intronic
1069178988 10:65332514-65332536 GTAGCTATACAGAGGGGACATGG - Intergenic
1070556480 10:77531808-77531830 GAGCCAAGAAAGAGGCAACAAGG + Intronic
1071571142 10:86698046-86698068 ATGGCTATAAAAAGGCGGCATGG - Intronic
1072413548 10:95228363-95228385 GAGGCTTAAATGAGGCAACATGG - Intronic
1079040268 11:17053026-17053048 GTGGGTTTAAAAAGGCAGCAAGG + Intergenic
1079150027 11:17890117-17890139 GTGGCTAAGAAGGGGCAGCAGGG + Intronic
1079781700 11:24615272-24615294 ATGGCTATAAAAAAGCAAAAAGG - Intronic
1082799782 11:57406153-57406175 GGGGCTATAAAGATGCAGAAGGG - Intronic
1086176216 11:83894142-83894164 GTGGTTACAAGAAGGCAACAAGG - Intronic
1087751954 11:102016330-102016352 GCGGCTAGGAAGAGGAAACAGGG + Intergenic
1089851470 11:121500567-121500589 GTACCTATACAGAGGCAATATGG + Intronic
1090182741 11:124715198-124715220 ATGGCTCTAAAGAGTAAACACGG + Intergenic
1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG + Intronic
1093480251 12:19597222-19597244 TTGGCTAAAAAGAAGCAACACGG + Intronic
1093872461 12:24308099-24308121 ATGCCTATTAAGAGGCAAAATGG + Intergenic
1099756934 12:86863647-86863669 GTGGGTATCAAAAGGCCACATGG + Intergenic
1103420559 12:120778534-120778556 GTGACTATAAAGAAAAAACAGGG - Intronic
1104639716 12:130459707-130459729 GTCGCAATACAGAGGGAACAGGG + Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1106981668 13:35291454-35291476 CTGGCTATAAAGAGGAAAATGGG - Intronic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1108945819 13:56021656-56021678 GTGTCTATAAATAGACAATAAGG + Intergenic
1112150329 13:96753211-96753233 ATGTATATAAAAAGGCAACAAGG - Intronic
1112684983 13:101814552-101814574 TTGGCTACAAAGAGGCAAAAGGG - Intronic
1113873828 13:113582321-113582343 GTGGCTATGGAGAGGAAAAAGGG + Intergenic
1117497880 14:56323739-56323761 GTTTCTCTAAAGAGGCAGCAGGG - Intergenic
1118438702 14:65793524-65793546 GTGGCTGAAGAGGGGCAACAGGG + Intergenic
1120466695 14:84866914-84866936 GTGTCAATAATGAGACAACAGGG - Intergenic
1120633357 14:86919828-86919850 CTGGCTATAAAAGGGAAACAAGG - Intronic
1121009359 14:90510865-90510887 GTGGCCTCAGAGAGGCAACATGG - Intergenic
1121106362 14:91282488-91282510 GATGCTATAAAAAAGCAACAGGG - Intronic
1122024543 14:98866163-98866185 GTGGCTACAGAGCGGCAGCAGGG + Intergenic
1127104303 15:55596734-55596756 GTGGCTATAAAGGGCTAACAAGG - Intergenic
1128426023 15:67542994-67543016 GTGGGTATGAGGAGGCAGCAGGG - Exonic
1129122891 15:73413471-73413493 GTGACTAGGAAGAGGCAACTGGG + Intergenic
1129315598 15:74741548-74741570 GTGGCTATAAAGCTAAAACAAGG + Intergenic
1136230913 16:28884695-28884717 GTGGGGAGGAAGAGGCAACAAGG + Intronic
1139658208 16:68401974-68401996 GTAGCCACAAAGAGGCAACAAGG + Intronic
1139658313 16:68402694-68402716 GTAGCCACAAAGAGGCAACAAGG + Intronic
1139909804 16:70390724-70390746 GTGGCTATAATAAGCCAAGAAGG + Intronic
1142545161 17:696209-696231 GTGACTATAAAGTGGAAAAATGG + Intronic
1143359771 17:6359452-6359474 ATCGCCACAAAGAGGCAACAAGG + Intergenic
1146317053 17:31815530-31815552 TTGGCTATAAAGAGGCCCCAGGG - Intergenic
1146545696 17:33736175-33736197 GGGGCTATAAAGAGGCCACCTGG + Intronic
1152221863 17:79073231-79073253 GGGGCTAACAAGAGGCCACAAGG + Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1153945032 18:10010459-10010481 ATGGCTATAAAGAGCCACAATGG + Intergenic
1156152845 18:34263946-34263968 ATAGCTATAAACATGCAACAGGG + Intergenic
1164519169 19:28964646-28964668 GTGGCTATGAAAGGGCAGCAGGG + Intergenic
1164913721 19:32032865-32032887 GTGGCTATAAAGAGGAATCTAGG - Intergenic
1166232935 19:41436175-41436197 TTTGCTATAAAGAGTGAACAGGG - Intronic
926151663 2:10428978-10429000 CTTGCTACAAAGAGGCAAGACGG + Intergenic
926989433 2:18661671-18661693 GAGGCTACAAAGGGGCAAGAGGG + Intergenic
933451520 2:82458958-82458980 GTGTGTATAAAGAGACAAAATGG - Intergenic
934987339 2:98897099-98897121 GTGGCTATAAAGGAGCAGCATGG - Intronic
935126315 2:100226597-100226619 GTGGCTATAAAACATCAACAGGG - Intergenic
936104326 2:109612328-109612350 GTGGTTATAAAAAGGCATTAAGG + Intronic
937888286 2:126915414-126915436 TTGGGTATACAGAGGCACCAGGG - Intergenic
938208464 2:129443686-129443708 GTGTCTGTAAAGAGGCACAAGGG - Intergenic
940651357 2:156443992-156444014 GTGGCTATAATGTGGCTGCAGGG - Intronic
943068418 2:183113391-183113413 GGGGTTATAAAAGGGCAACATGG + Intergenic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
943721803 2:191212047-191212069 ATGGCTATAATGAAGTAACAGGG - Intergenic
944481613 2:200163166-200163188 GTGACTGTAAAGGGGCAAAAGGG + Intergenic
944939483 2:204608131-204608153 GTGGCTTCAGACAGGCAACAGGG + Intronic
945644925 2:212479249-212479271 GGGGCTTTAAAGAGGCAATCAGG - Intronic
945859114 2:215100330-215100352 GTGGCTTTCAAGAGGCAGAAGGG - Intronic
945925103 2:215795224-215795246 GTGCCTCTAAAGACTCAACAAGG - Intergenic
948288073 2:236802647-236802669 GTGCTTTTAAAGAGGCAAGAAGG - Intergenic
949005929 2:241647769-241647791 GTGGCTTTAGAGAGGTAGCAGGG + Intronic
1169975082 20:11316012-11316034 TTGGCTACAAAGAGGCACAAGGG + Intergenic
1174394529 20:50238581-50238603 GCGGATATGAAGAGACAACAGGG - Intergenic
1178895488 21:36553877-36553899 GTGGCTAAACAGAGTCAACATGG - Intronic
1180842191 22:18964661-18964683 GTGGCTGAGAAGAGGCCACATGG - Intergenic
1180911997 22:19457268-19457290 ATGGTTATAAAAAGACAACATGG - Intronic
1181059307 22:20274220-20274242 GTGGCTGAGAAGAGGCCACATGG + Intronic
1183261199 22:36797057-36797079 GTGGCCATAAAGGCCCAACATGG - Intergenic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
951532257 3:23709139-23709161 GTGGTTATAAAGAAGCAAAGTGG + Intergenic
953643603 3:44732029-44732051 CTGGCAATCAAAAGGCAACATGG + Intronic
955074339 3:55599205-55599227 GTGGCTGTAAGCAGGCAACGTGG - Intronic
956616105 3:71174360-71174382 GTGGCTATTTAGAGGCAGCTGGG - Intronic
965040177 3:163498099-163498121 GTGTCTATAAAAAGGGAAAAAGG + Intergenic
966971227 3:185047302-185047324 GTGGCTATGAAGATTCAAGAAGG - Intronic
967164729 3:186770471-186770493 GTGGCTATTAAAGGGCAACATGG - Intergenic
969887210 4:10225812-10225834 TTGGGTATTAAGAGTCAACAAGG - Intergenic
969991826 4:11272181-11272203 GTGCCTTTAAAGAGGTAACTAGG - Intergenic
970149014 4:13069423-13069445 TTGGCTTTACAGAGGCAAAAGGG - Intergenic
970221887 4:13820258-13820280 GAGGCCAGAAAGAGGCAAGAAGG + Intergenic
976501774 4:85798395-85798417 GTGACTATAAAGGAGCAAGAAGG + Intronic
976581018 4:86737575-86737597 CTGACTATAAAGAGACAAGAGGG - Intronic
977728554 4:100325334-100325356 TTGGCTAGAAATTGGCAACATGG - Intergenic
979031301 4:115651632-115651654 GAAGCTAGAAAGAGGCAAGAAGG - Intergenic
979703468 4:123693367-123693389 GTAGGTATAAAGAGGCCCCAAGG - Intergenic
983058923 4:163132591-163132613 GTGACTATAAAGAGGCAACTGGG + Intronic
983644450 4:169975854-169975876 GTGGTGATAAAGAGGCCACGAGG + Intergenic
983695712 4:170527547-170527569 GTAGCTATAAGGATGAAACACGG - Intergenic
986817059 5:11424341-11424363 GTGGCTAAAAAGGGGTAGCACGG + Intronic
990444515 5:55881665-55881687 ATGGCCATTAAGAGGCAAAATGG - Intronic
993050739 5:82923198-82923220 CTGGCTGTAAGGAGGCAGCAGGG - Intergenic
995239092 5:109865553-109865575 GTAGCCATAAAGAAGCAACTGGG + Intronic
997349701 5:133221691-133221713 GTCTCTATAAAGGGGGAACAAGG + Intronic
998615874 5:143740087-143740109 ATGGCCATAGATAGGCAACAAGG - Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
1000353800 5:160373870-160373892 GTGGATAGAAAGAGGAAAGAAGG - Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1001901721 5:175436529-175436551 GTGGACAGACAGAGGCAACAGGG + Intergenic
1002650954 5:180693251-180693273 GTGGCCACACAGAGGCAAAATGG + Intergenic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1003372716 6:5544189-5544211 CTGGCTGTGAAGAGGCCACATGG - Intronic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1004242419 6:13936840-13936862 AGAGCTATAAAGAGGGAACAGGG + Intronic
1004519966 6:16352628-16352650 GTGGCTCAAAAGAAGCATCATGG + Intronic
1004805006 6:19193889-19193911 GTGGTTATAAAGAGGCTAGGAGG + Intergenic
1005244733 6:23869933-23869955 GTGGCTATAAAAGGGAAACAGGG + Intergenic
1006861914 6:37177416-37177438 GTGGCTATAAAGAGGAAGGAAGG + Intergenic
1007054317 6:38867308-38867330 GTGGCTATAAAGTAGCATGAGGG - Intronic
1007743806 6:44029938-44029960 TTGGATAGAAAGAGGCAAGATGG - Intergenic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1014975351 6:127874735-127874757 ATGGCTATAAAAAAGCAACATGG + Intronic
1017041633 6:150313080-150313102 ATGGCTATAAAAAGGACACACGG + Intergenic
1017649999 6:156571941-156571963 GTGCTTATAAAGAGGAAACCAGG + Intergenic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1020684959 7:11283413-11283435 TTGGCTATAAAGAGGCCAAGAGG + Intergenic
1020736783 7:11959859-11959881 AAGGCAAAAAAGAGGCAACAGGG + Intergenic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1027004348 7:74679732-74679754 CTGGCTGTAAAGAGGCAATTTGG + Intronic
1027154473 7:75756778-75756800 GTGGCTATCAGTCGGCAACAGGG - Intergenic
1027478160 7:78659661-78659683 GTGGCTATAAAAGGACAACATGG + Intronic
1028145509 7:87316049-87316071 GTGGCTTTAAAAAGGCAAATCGG + Intergenic
1028839952 7:95418465-95418487 GTGGCTTTACAGAGGAATCAGGG - Intronic
1033399917 7:141012789-141012811 TTGTCAATGAAGAGGCAACAGGG + Intronic
1034493859 7:151409028-151409050 TTGGCCACAAAGAGGCCACAAGG + Intronic
1035796972 8:2366727-2366749 GTGGCTCTGAGGAGGCAGCAAGG + Intergenic
1038688055 8:29736718-29736740 GGTGTTATTAAGAGGCAACATGG - Intergenic
1040943662 8:52858313-52858335 GTGGCTATAAAAGGGGAACTTGG - Intergenic
1041768142 8:61442048-61442070 GTGCCTATAAAAGGGTAACATGG - Intronic
1042062080 8:64830510-64830532 GTGACTACAAAAAGGTAACATGG - Intergenic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1044344850 8:91093324-91093346 GTGGCAAGAAAGTGGCATCAGGG + Intergenic
1045921567 8:107536070-107536092 GTTCCTATAGAAAGGCAACATGG - Intergenic
1047620135 8:126597966-126597988 GTGGCTGTAAAGAAGTATCAGGG - Intergenic
1048053109 8:130837892-130837914 TTGGCTATAAAGTGGCATCTAGG + Intronic
1050029176 9:1367271-1367293 GTTGCTATAAAGAAGCACCTGGG + Intergenic
1050868507 9:10535854-10535876 GAGGCCATAAAGAGGTAAAAGGG - Intronic
1052726799 9:32238317-32238339 ATGGCTATAAAAGGACAACATGG + Intergenic
1056098962 9:83282301-83282323 GTGGTTCAAAAGAGGCAAAATGG + Intronic
1056914660 9:90735619-90735641 GTGGCTATAAAAGGTTAACATGG + Intergenic
1057956125 9:99409441-99409463 GTGGCTACAAAGAGAGAACATGG - Intergenic
1059191008 9:112326079-112326101 GGGTCTGGAAAGAGGCAACAGGG + Intronic
1062026097 9:134341514-134341536 GTTGCTAAAAAGAGCCAACGGGG - Intronic
1062201196 9:135303700-135303722 GTGGTTAGAAAGAGGCTGCATGG - Intergenic
1185826099 X:3251403-3251425 GTGGCTATAAATAATCAAAATGG - Intergenic
1187419037 X:19119048-19119070 CTGACTACAAAGAGTCAACAGGG + Intronic
1187530249 X:20090002-20090024 TTGACTGTAAAGAGGCAAAAGGG - Intronic
1193643133 X:84036154-84036176 GTGGCTATAAAAGACCAACATGG - Intergenic
1193754708 X:85394281-85394303 GTGATTATAAAGGAGCAACATGG - Intergenic
1194947706 X:100089319-100089341 GTGACTAGAAAGGGGCAACAGGG + Intergenic
1199596187 X:149507950-149507972 GAGGATATAGAGAGGCAGCAAGG + Intronic
1200333870 X:155326946-155326968 GTGGCTTTAAAAGGGCAACACGG + Intronic