ID: 1153619465

View in Genome Browser
Species Human (GRCh38)
Location 18:6963377-6963399
Sequence CTTCCTGCCAAGACGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153619465_1153619468 10 Left 1153619465 18:6963377-6963399 CCTGGCTCCGTCTTGGCAGGAAG 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1153619468 18:6963410-6963432 GCAAGTGACCAACTCCGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 58
1153619465_1153619470 19 Left 1153619465 18:6963377-6963399 CCTGGCTCCGTCTTGGCAGGAAG 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1153619470 18:6963419-6963441 CAACTCCGCTGAGGTTTAAATGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153619465 Original CRISPR CTTCCTGCCAAGACGGAGCC AGG (reversed) Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
900986729 1:6077604-6077626 TTTCCTCCCAGGAGGGAGCCAGG + Intronic
901499649 1:9643942-9643964 CTTCCTGCCAGGATGGGGCATGG + Intergenic
903606146 1:24576456-24576478 TTTCCTGCCAAGCCTGGGCCTGG - Intronic
904208591 1:28871193-28871215 CTTGGTACCAAGATGGAGCCTGG - Intergenic
907624375 1:56014249-56014271 CATCCTTCCAAGACTGAACCAGG + Intergenic
908185400 1:61648052-61648074 CTTCCACCCAATACAGAGCCTGG - Intergenic
908283565 1:62569022-62569044 CATCCTCCCAAGACTGAACCAGG + Intronic
909051197 1:70770399-70770421 CACCCTCCCAAGACTGAGCCAGG - Intergenic
910575614 1:88759795-88759817 CAACCTCCCAAGACTGAGCCAGG + Intronic
911272634 1:95821729-95821751 CATCCTCCCAAGACTGAACCAGG - Intergenic
911874279 1:103139139-103139161 CATCCTCCCAAGACTGAACCAGG + Intergenic
911979873 1:104553776-104553798 CATCCTTCCAAGACTGAGCCAGG + Intergenic
912639117 1:111327570-111327592 CACCCTCCCAAGACTGAGCCAGG - Intergenic
913411060 1:118552088-118552110 CACCCTCCCAAGACTGAGCCAGG + Intergenic
918165625 1:181944402-181944424 CATCCTCCCAAGACTGAACCAGG + Intergenic
918299120 1:183186199-183186221 CTTCCTGTCAGGACTGAGTCAGG + Intergenic
918665893 1:187150503-187150525 CAACCTACCAAGACTGAGCCAGG - Intergenic
918982631 1:191583122-191583144 TATCCTCCCAAGACCGAGCCAGG - Intergenic
919320292 1:196027842-196027864 CTTCCTTCCAGAATGGAGCCAGG - Intergenic
919785110 1:201253841-201253863 CTGCCTTCCAAGGCGAAGCCAGG + Intergenic
920095623 1:203484637-203484659 CTTCTTCCCAAGCCTGAGCCTGG + Intronic
920336238 1:205247273-205247295 CTCCCTGCCAAGACCTAGCTGGG - Intronic
923664980 1:235991765-235991787 CTCCCTGCCCACAGGGAGCCAGG + Intronic
923827887 1:237520679-237520701 CTCCCTCCCAAGACTGAACCAGG + Intronic
1062829281 10:594655-594677 CTTCCTGTCAGGAAGCAGCCAGG - Intronic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1063211860 10:3887993-3888015 TTTCCTGGCAAAACGGAGCCTGG + Intergenic
1063365049 10:5485632-5485654 CTCGGTGACAAGACGGAGCCAGG + Intergenic
1065005188 10:21373220-21373242 CTTCCTGCCAACACCCAGCAAGG + Intergenic
1066522832 10:36241968-36241990 CCTCCTCCCAAGACTGAACCAGG + Intergenic
1068053280 10:51979706-51979728 CATCCTCCCAAGACTGAGTCAGG - Intronic
1068461794 10:57338975-57338997 CTTCCTGCCAAAAAGGGGCGTGG + Intergenic
1068643695 10:59440724-59440746 CAACCTGCCAAGATTGAGCCAGG + Intergenic
1070886983 10:79909310-79909332 CACCCTCCCAAGACTGAGCCAGG - Intergenic
1071002984 10:80852182-80852204 TTTCCTGCCAAGACTAATCCTGG - Intergenic
1072610507 10:97014449-97014471 CTTTGTGCCAAGGAGGAGCCAGG - Intronic
1073379437 10:103066563-103066585 CTCCCTGCAAACACAGAGCCTGG + Intronic
1075672993 10:124276785-124276807 CTTCCTGCCAGGCCAGTGCCAGG + Intergenic
1076377858 10:130003466-130003488 CTGCCTGCAAAGACAGAGCTGGG + Intergenic
1076697946 10:132256104-132256126 ATCGCTGCCAAGATGGAGCCTGG - Intronic
1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG + Intronic
1076834669 10:133014989-133015011 CTTCCTGCCCAGAGGCAGCCCGG - Intergenic
1077395192 11:2317040-2317062 CTTCCTGCCCCCACGGAGCCTGG + Intronic
1077984546 11:7338074-7338096 CATCCTCCCAAGACTGAACCAGG - Intronic
1078090029 11:8259362-8259384 CTTCCTGCCCAAACTTAGCCAGG - Intronic
1079437543 11:20472959-20472981 CACCCTCCCAAGACTGAGCCAGG - Intronic
1079847812 11:25491903-25491925 CTCCCTCCCAAGACTGAGCCAGG - Intergenic
1080214998 11:29830464-29830486 CATCCTCCCAAGACTGAACCAGG + Intergenic
1080225322 11:29953686-29953708 CACCCTCCCAAGACTGAGCCAGG + Intergenic
1080388469 11:31823994-31824016 ATCCCTGCAAAGACGGAGCCTGG + Intronic
1081585649 11:44382050-44382072 ATTCCTGCAAAGACGGCCCCAGG + Intergenic
1081795096 11:45813256-45813278 CTACCTTCCAGGAAGGAGCCTGG - Intergenic
1081854117 11:46293335-46293357 CCTCCTGCCCAGACAGTGCCTGG + Intronic
1084746788 11:71175621-71175643 CTTCCAGCCAAGATGGAGGAAGG + Intronic
1086986503 11:93255814-93255836 CTGCCTGCTAAAAGGGAGCCAGG - Intergenic
1086995200 11:93348057-93348079 CATCCTCCCAAAACTGAGCCAGG - Intronic
1087171887 11:95057815-95057837 CCTCCTGGCCAGATGGAGCCTGG - Intergenic
1087210925 11:95446079-95446101 ATGCCTGCCAAGGGGGAGCCAGG + Intergenic
1087817094 11:102671255-102671277 CAACCTGCCAAGACTGAACCGGG - Intergenic
1088561569 11:111120812-111120834 TTTCCTTCCAAGAGGAAGCCTGG - Intergenic
1089131317 11:116214550-116214572 CTGCCTCCCAAGATGGTGCCAGG + Intergenic
1089605159 11:119637565-119637587 CTTCCTGCCAAGAGTGAGGATGG + Intronic
1089703943 11:120263797-120263819 CATCTTCCAAAGACGGAGCCAGG + Intronic
1090395100 11:126413827-126413849 CTTCCTTCCAAGAGCCAGCCTGG + Intronic
1090847220 11:130540222-130540244 CACCCTCCCAAGACTGAGCCAGG - Intergenic
1091605629 12:1949157-1949179 CCTCCTGCCCATACAGAGCCCGG - Exonic
1091850145 12:3689862-3689884 CACCCTTCCAAGACTGAGCCAGG - Intronic
1094431712 12:30376979-30377001 CACCCTGCCAAGACTGAACCAGG - Intergenic
1095824031 12:46512804-46512826 CACCCTCCCAAGACTGAGCCAGG - Intergenic
1096098773 12:48956611-48956633 CTTCCTCCCCAGGCGGAGCGGGG - Intronic
1097583275 12:61484355-61484377 CATCCTCCCAAGACTGAACCAGG + Intergenic
1097684357 12:62677641-62677663 ATGCCTGCCAAGAGTGAGCCAGG - Intronic
1098678892 12:73325038-73325060 CACCCTGCCAAGACTGAACCAGG + Intergenic
1098883510 12:75940689-75940711 TTTGCTGGGAAGACGGAGCCAGG + Intergenic
1099393965 12:82115510-82115532 CATCCTCCCAAGACTGAACCAGG - Intergenic
1101429520 12:104615366-104615388 CATCCTGCCAAGGCAGAGCTTGG + Intronic
1105396399 13:20040300-20040322 CACCCTCCCAAGACTGAGCCAGG - Intronic
1108031800 13:46239415-46239437 CATCCTCCCAAGACTGAACCAGG + Intronic
1108046700 13:46390135-46390157 CTGCCTGCCAAAACCCAGCCAGG + Intronic
1108697024 13:52911428-52911450 CATCCTGCTCAGACAGAGCCAGG - Intergenic
1108976327 13:56447586-56447608 CACCCTCCCAAGACTGAGCCAGG + Intergenic
1109974294 13:69810902-69810924 CTACCTCCCAAGACTGAGCTAGG + Intronic
1111101620 13:83595688-83595710 TATCCTACCAAGACTGAGCCAGG - Intergenic
1113437382 13:110303826-110303848 CTTCCTGCCATGACCTTGCCAGG - Intronic
1114482298 14:23043342-23043364 CTTGGTGCCAAGAAGGAGGCTGG - Exonic
1114586846 14:23823108-23823130 CACCCTCCCAAGACTGAGCCAGG - Intergenic
1115570841 14:34664814-34664836 CTTTCTGCCATAACGGAGCAAGG - Intergenic
1115885447 14:37966636-37966658 CAACCTCCCAAGACTGAGCCAGG - Intronic
1115927511 14:38452152-38452174 CACCCTGCCAAGACTGAACCAGG + Intergenic
1116428978 14:44823879-44823901 CACCCTGCCAAGACTGAACCAGG + Intergenic
1120405863 14:84092244-84092266 ATGCCTGCCAAGAGTGAGCCAGG - Intergenic
1120685137 14:87529222-87529244 CTTGCAGACAAGAGGGAGCCTGG - Intergenic
1120867036 14:89304280-89304302 CTTCCTGCTGAGCTGGAGCCCGG + Intronic
1121929070 14:97955936-97955958 CTTCCTGCCCTTAGGGAGCCTGG + Intronic
1122025021 14:98869390-98869412 CTTCCTCCCAGGAAGGACCCTGG + Intergenic
1122874684 14:104658574-104658596 CATCCGCCCACGACGGAGCCTGG + Intergenic
1124197241 15:27642534-27642556 CTTCCTCCCAAGACTGAACCAGG + Intergenic
1127100231 15:55556924-55556946 CATCCTCCCAAGACTGAACCAGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129584954 15:76853106-76853128 CTCCCTCCCAAGACTGAACCAGG + Intronic
1130029856 15:80302622-80302644 CATCCTCCCAAGACTGAACCAGG - Intergenic
1136630034 16:31484711-31484733 CTTCCTGGCAGGACGCAGCATGG + Exonic
1139963326 16:70730416-70730438 CTTCAAGGCAAGAAGGAGCCTGG - Intronic
1140209950 16:72961950-72961972 CTTCCTCGCAAGGCTGAGCCGGG + Intronic
1140322150 16:73963340-73963362 CTTCCTCCCAAGATGGCGGCTGG - Intergenic
1140473635 16:75228007-75228029 TTGCCTGCCAGGATGGAGCCTGG + Intergenic
1140970836 16:80010669-80010691 CATCCTCCCAAGACTGATCCAGG + Intergenic
1141704051 16:85655034-85655056 GTTCCTGGCAAGATGGAACCTGG + Intronic
1142246491 16:88972546-88972568 CTTTCTGCCATGACTGACCCAGG + Intronic
1143579081 17:7814092-7814114 CTTCCTGCCATTCCTGAGCCTGG - Intronic
1146061003 17:29607402-29607424 CTGCCTGCCAAGAATAAGCCTGG - Intronic
1146760557 17:35473858-35473880 CAACCTCCCAAGACTGAGCCAGG - Exonic
1146941221 17:36845648-36845670 CTTCCTGGCAAGAAGGGGCCAGG + Intergenic
1147251324 17:39154187-39154209 CTTCCCGCCAAGAAAGAGCCAGG + Intronic
1149114537 17:53076486-53076508 CACCCTCCCAAGACTGAGCCAGG - Intergenic
1150623420 17:66824834-66824856 CCTGCTCCCAGGACGGAGCCTGG + Intergenic
1151421116 17:73998674-73998696 GCTCCTGCCCACACGGAGCCTGG + Intergenic
1151490074 17:74427604-74427626 CTTCCTGACAAGTTGGGGCCTGG - Intronic
1151748264 17:76023006-76023028 GTTCCTGCCAGGAGGAAGCCTGG - Intronic
1152318142 17:79592886-79592908 CTCCCTGCCCAGAAGGAACCTGG + Intergenic
1152555754 17:81052415-81052437 CTTCCTTCCAGGACGCAGCAAGG - Intronic
1153619465 18:6963377-6963399 CTTCCTGCCAAGACGGAGCCAGG - Intronic
1157315678 18:46587546-46587568 CTTCTTGCCAGGAAGGAGCTCGG - Intronic
1163699864 19:18781710-18781732 CATCCTGCCCAGGAGGAGCCCGG - Exonic
1166294673 19:41883186-41883208 CTTCCTGCCCCGCCAGAGCCAGG + Intronic
1166555850 19:43699529-43699551 CCGCCTGCCGAGACGGAGACAGG - Intergenic
1166585709 19:43946366-43946388 CATCCTCCCAAGACCGAACCAGG - Intergenic
1166912254 19:46167384-46167406 CTACCTGCCACCACGGAGCCAGG - Intergenic
1167036652 19:46998921-46998943 CTTCCTGACCAGATGGAGACGGG - Intronic
1167560615 19:50224698-50224720 GTTCCTGCCAAGGAGTAGCCTGG + Intronic
925613809 2:5726057-5726079 CTTCCTGTGAAACCGGAGCCAGG - Intergenic
925917861 2:8619501-8619523 ATTCCTGCCAAGAAGCAGCCAGG + Intergenic
927126724 2:20019068-20019090 CTTCTTCCCTAGAAGGAGCCTGG - Intergenic
928680333 2:33694628-33694650 CACCCTCCCAAGACTGAGCCAGG - Intergenic
929014702 2:37482478-37482500 ATGCCTGCCAAGAGTGAGCCAGG - Intergenic
930592369 2:53343213-53343235 CATCCTCCCAAGACTGAGCCAGG - Intergenic
931360771 2:61575853-61575875 CTTCTTGCCAAAGAGGAGCCAGG - Intergenic
931537540 2:63295688-63295710 CGTCCTCCCAAGATTGAGCCAGG + Intronic
931649367 2:64454374-64454396 CTGCCTGCCAGGTCGGCGCCGGG + Exonic
931889752 2:66658511-66658533 CACCCTCCCAAGACTGAGCCAGG - Intergenic
936071499 2:109374555-109374577 CCACCTGCCAGGAGGGAGCCTGG + Intronic
938621121 2:133054464-133054486 CAACATGCCAAGAGGGAGCCTGG + Intronic
941440704 2:165531987-165532009 CATCCTCCCAAGACGAAACCAGG + Intronic
941906248 2:170717509-170717531 CTGCCTCCCAAAATGGAGCCAGG + Exonic
942792963 2:179781752-179781774 CATCCTGCCAAGACTGAGCCAGG + Intronic
1175899419 20:62354160-62354182 CGTCCTGTGAAGACTGAGCCAGG - Intronic
1176342417 21:5710621-5710643 CTCTCTGACAAGACAGAGCCCGG + Intergenic
1176474671 21:7142773-7142795 CTCTCTGACAAGACAGAGCCCGG + Intergenic
1176502410 21:7613835-7613857 CTCTCTGACAAGACAGAGCCCGG - Intergenic
1176536738 21:8108690-8108712 CTCTCTGACAAGACAGAGCCCGG + Intergenic
1178334226 21:31730172-31730194 CTTCCTGCCCTCATGGAGCCAGG + Intronic
1179526265 21:41977867-41977889 CTTCCTGGCAGCAGGGAGCCTGG - Intergenic
1179548641 21:42128734-42128756 CTCCCTGCAGAGACGAAGCCTGG - Intronic
1180025992 21:45162411-45162433 ATGCCTGCCAAGGGGGAGCCAGG - Intronic
1180124000 21:45775222-45775244 CAACCTGCCAAGACTGAGTCAGG - Intronic
1181054379 22:20253144-20253166 CTTCCAGCCCAGATGCAGCCAGG - Intronic
1182271661 22:29157690-29157712 CTTCCTGAAAACACGGAGGCTGG + Intronic
1182390813 22:29994038-29994060 CTTCCTGCCCAGGCTGATCCAGG + Intronic
1183027633 22:35077711-35077733 CTGCCTGCCAAGTCATAGCCTGG - Intronic
1183317264 22:37143532-37143554 CTTCCTGCCAAGTCCATGCCTGG - Exonic
1184510009 22:44927933-44927955 CTTCCTGCCATGGCTGAGTCTGG + Intronic
1185081829 22:48713779-48713801 CTTCCTGCAAGCTCGGAGCCTGG + Intronic
1185155523 22:49191433-49191455 CCTCCTTCCGAGACGGAGCTGGG - Intergenic
1203241685 22_KI270733v1_random:25101-25123 CTCTCTGACAAGACAGAGCCCGG + Intergenic
949817079 3:8069885-8069907 CTTCCTGCCATGACCCAGCAAGG + Intergenic
950969377 3:17170801-17170823 CTCCCTGCCAAGATGATGCCAGG - Intronic
952026625 3:29090337-29090359 CACCCTCCCAAGACTGAGCCAGG + Intergenic
953044793 3:39284798-39284820 CTTCCTGCCCAGATGCAGGCAGG + Intergenic
953053224 3:39365252-39365274 CACCCTGCCAAGACTGAACCAGG + Intergenic
953457706 3:43055840-43055862 CTGCCTGCCAAGAGTGAGCTGGG - Intronic
956355233 3:68383890-68383912 CATCCTCCCAAGACTGAACCAGG - Intronic
956890802 3:73612373-73612395 CTGCCTCCAAAGACTGAGCCTGG + Intronic
958082518 3:88764632-88764654 CACCCTCCCAAGACTGAGCCAGG - Intergenic
958849620 3:99308254-99308276 CACCCTCCCAAGACTGAGCCAGG - Intergenic
959766946 3:110042455-110042477 CACCCTCCCAAGACTGAGCCAGG - Intergenic
965318064 3:167215407-167215429 CACCCTCCCAAGACTGAGCCAGG + Intergenic
966977750 3:185100961-185100983 CATCCTCCCGAGACTGAGCCAGG + Intronic
967095645 3:186175182-186175204 TTTCCAGCCAAGATGGAGGCTGG + Intronic
967592165 3:191291041-191291063 CATCCTGACAAGACGGTGCTTGG + Intronic
967992915 3:195144874-195144896 CTTCCTGCCAAGATGTTGGCAGG - Intronic
969604863 4:8197431-8197453 CTTCCTCCTCAGACGCAGCCGGG + Intronic
969649382 4:8455194-8455216 CTGCCTGCCAGGACTGCGCCAGG + Intronic
970413507 4:15834092-15834114 GTCACTGCCAAGACGGAGGCTGG - Intronic
970734825 4:19153517-19153539 CTCCCTCCCAAGACTGAACCAGG - Intergenic
972351438 4:38239821-38239843 CTTCTTGCCAGGACTGAGCAAGG + Intergenic
974722983 4:65765958-65765980 CACCCTCCCAAGACTGAGCCAGG - Intergenic
976431246 4:84966020-84966042 CTCCCGGCCAAGGCGGACCCTGG + Intronic
976439484 4:85056686-85056708 CTTCCTGCCAAGTGGGATACTGG - Intergenic
977987756 4:103404584-103404606 CTTCCCCCCGAGACGGAGTCTGG + Intergenic
978043314 4:104096072-104096094 CATCCTCCCAAGACTGAGCCAGG + Intergenic
979811320 4:125039633-125039655 CTTCCTGGCAAGAATGAGCAGGG + Intergenic
980548005 4:134294971-134294993 CACCCTCCCAAGACTGAGCCAGG + Intergenic
985831331 5:2234318-2234340 CATCCTCCCAAGACTAAGCCAGG - Intergenic
986100635 5:4607055-4607077 CATGCTCCCAAGACTGAGCCAGG + Intergenic
987611775 5:20213589-20213611 CTCCCTTCCAAGACTGAACCAGG - Intronic
988178226 5:27755296-27755318 CATCCTCCTAAGACGGAACCAGG + Intergenic
988870878 5:35388188-35388210 CATCCTCCCAAGACTGAACCAGG + Intergenic
990390602 5:55316064-55316086 CACCCTCCCAAGACTGAGCCAGG + Intronic
990922889 5:60987205-60987227 CATTCTCCCAAGACTGAGCCAGG + Intronic
990940422 5:61197532-61197554 CACCCTCCCAAGACTGAGCCAGG - Intergenic
991346782 5:65677257-65677279 CATCCTCCCAAGACTGAACCAGG + Intronic
992355647 5:75980145-75980167 CATCCTGCCAAAACTGAACCAGG + Intergenic
994451687 5:99951418-99951440 ATGCCTGCCAAGAGTGAGCCAGG - Intergenic
994713019 5:103288723-103288745 CTCCATGACAAGAAGGAGCCAGG + Intergenic
994897554 5:105725057-105725079 CACCCTCCCAAGACTGAGCCAGG + Intergenic
994970787 5:106734024-106734046 CACCCTCCCAAGACTGAGCCAGG + Intergenic
996563106 5:124851600-124851622 CTTCCTTTCGAGACGGAGTCTGG + Intergenic
996953904 5:129160761-129160783 CATTCTCCCAAGACTGAGCCAGG - Intergenic
997477462 5:134152949-134152971 CTTCCTACCAAGGAGAAGCCAGG + Exonic
999070813 5:148741720-148741742 CAACCTCCCAAGACTGAGCCAGG + Intergenic
1000606836 5:163335683-163335705 CGGCCTGGCAAGAAGGAGCCTGG - Intergenic
1002425995 5:179176305-179176327 CTTGCTGCCTAGGGGGAGCCTGG - Intronic
1002564486 5:180102042-180102064 CTTCCTGCCAAGGTGGGGCCTGG - Intronic
1002774122 6:314309-314331 CTTCCTACCAAGCCCCAGCCTGG - Intronic
1003241595 6:4350142-4350164 CCTCCGGCCAACACTGAGCCTGG + Intergenic
1006478516 6:34273409-34273431 CTTCCTGCCAGGCCTGTGCCTGG - Intergenic
1007106032 6:39283608-39283630 CTTCCTGACAACACGGCGGCTGG - Intergenic
1008677694 6:53838022-53838044 CTTCCTGCCAAGACAGCTACAGG + Intronic
1009663219 6:66641920-66641942 CTCCCTCCCAAGACTGAACCAGG + Intergenic
1009729577 6:67582706-67582728 CATCCTCCCAAGACTGAGCCAGG - Intergenic
1011392630 6:86870904-86870926 CAACCTCCCAAGACTGAGCCAGG + Intergenic
1012089242 6:94870996-94871018 CATCCTTCCAAGACTAAGCCAGG - Intergenic
1012810234 6:103947913-103947935 CATCCTCCCAAGACCGAACCAGG - Intergenic
1015197978 6:130544858-130544880 CATCCTCTCAAGACTGAGCCAGG + Intergenic
1016778143 6:147928379-147928401 CATCCTGCCAAGACTGAACCAGG - Intergenic
1017396109 6:154002090-154002112 ATGCCTGCCAAGAGTGAGCCAGG + Intergenic
1019418611 7:938568-938590 CTTCGGGAGAAGACGGAGCCCGG - Intronic
1020382243 7:7559423-7559445 CAACCTCCCAAGACTGAGCCAGG + Intergenic
1020670384 7:11099927-11099949 GTTCCTGCCAAGAGGGAGGAAGG - Intronic
1020862581 7:13513472-13513494 CACCCTCCCAAGACTGAGCCAGG + Intergenic
1021175650 7:17446779-17446801 CACCCTCCCAAGACTGAGCCAGG - Intergenic
1021347368 7:19544975-19544997 CTTCCTCCCAAGACTAAACCAGG - Intergenic
1022075967 7:26970879-26970901 CACCCTTCCAAGACTGAGCCAGG - Intronic
1024859834 7:53825812-53825834 CATCCTTCCAAGACTGAACCAGG + Intergenic
1026458227 7:70591331-70591353 CTTCCTGTCAAGGAGTAGCCTGG - Intronic
1028168132 7:87563090-87563112 CATCCTCCCAAGACTGAACCAGG + Intronic
1028644463 7:93079814-93079836 CATCCTGCCAAGACTAAACCAGG + Intergenic
1029460366 7:100690885-100690907 CTTGCAGCCAAGACACAGCCAGG - Intergenic
1030200650 7:106900067-106900089 CACCCTCCCAAGACTGAGCCAGG - Intronic
1032148778 7:129409256-129409278 CTTCCTGATAATAGGGAGCCAGG - Intronic
1032217708 7:129970370-129970392 CATCCAGCCAAGACCTAGCCAGG + Intergenic
1032591070 7:133193055-133193077 ATACCTGCCAAGAGTGAGCCAGG + Intergenic
1033957598 7:146870294-146870316 CAGCCTCCCAAGACTGAGCCAGG - Intronic
1035885641 8:3288512-3288534 CATCCTGCCAAGACTAAACCAGG - Intronic
1036146996 8:6263308-6263330 CTTCCTGTAAGGACAGAGCCAGG + Intergenic
1036795946 8:11757021-11757043 CGTCCCATCAAGACGGAGCCTGG + Exonic
1039025083 8:33249766-33249788 CATCCTCCCAAGACTGAACCAGG - Intergenic
1043281079 8:78467312-78467334 CACCCTCCCAAGACTGAGCCAGG + Intergenic
1044214151 8:89587798-89587820 CACCCTCCCAAGACTGAGCCAGG + Intergenic
1045594190 8:103633744-103633766 CACCCTTCCAAGACAGAGCCAGG - Intronic
1048029679 8:130619540-130619562 CATCCTCTCAAGACTGAGCCAGG - Intergenic
1050166876 9:2774208-2774230 CATCCTCCCAAGACTGAACCAGG + Intronic
1052164063 9:25300328-25300350 CGTCCTGCACAGAGGGAGCCAGG - Intergenic
1052767240 9:32653814-32653836 CATCCTCCCAAGACTGAACCAGG + Intergenic
1053365212 9:37517982-37518004 CCTCCTGCCAGGACTCAGCCTGG - Intronic
1056375095 9:86000611-86000633 CACCCTCCCAAGACTGAGCCAGG - Intronic
1057111237 9:92473144-92473166 CTTCCTGCCATGAGGTAGCTTGG + Intronic
1057172848 9:92974186-92974208 CTGTCTGGCAAGACAGAGCCTGG - Intronic
1058199761 9:102024968-102024990 CTCCCTCCCAAGACTGAACCAGG - Intergenic
1062090998 9:134678838-134678860 CTTTTTGCCAAGGCAGAGCCTGG + Intronic
1186492401 X:9984209-9984231 CCTGCTGCCAATACAGAGCCAGG + Intergenic
1189307010 X:39994527-39994549 CTTCCTACCAAGATGGAGGTGGG + Intergenic
1190599434 X:52074597-52074619 CACCCTCCCAAGATGGAGCCAGG - Intergenic
1190609390 X:52179476-52179498 CACCCTCCCAAGATGGAGCCAGG + Intergenic
1191738563 X:64413262-64413284 CGCCCTTCCAAGACGGAACCAGG - Intergenic
1191919254 X:66236832-66236854 CGCCCTCCCAAGACAGAGCCAGG - Intronic
1191922678 X:66273564-66273586 CATCCTCTCAAGACTGAGCCAGG + Intergenic
1192253959 X:69439322-69439344 CACCCTCCCAAGACAGAGCCAGG - Intergenic
1193005454 X:76613816-76613838 CACCCTCCCAAGACTGAGCCAGG + Intergenic
1193299372 X:79871140-79871162 CATCCTCCCAAGACTGAGCAAGG + Intergenic
1193324828 X:80167875-80167897 CATCCTTCCAAGTCTGAGCCAGG - Intergenic
1193703690 X:84794140-84794162 CAACCTCCCAAGACTGAGCCAGG + Intergenic
1193704570 X:84805606-84805628 CACCCTCCCAAGACTGAGCCAGG + Intergenic
1193736869 X:85167565-85167587 CATCCTCCCAAGACTGAACCAGG + Intergenic
1194468739 X:94266167-94266189 CAACCTCCCAAGACTGAGCCAGG + Intergenic
1194632220 X:96299165-96299187 CATCCTCCCAAGACTGAACCAGG + Intergenic
1194854414 X:98911656-98911678 CATCGTCCCAAGACTGAGCCAGG - Intergenic
1195149768 X:102054896-102054918 CATCCTACCAAGACTGAGCCAGG + Intergenic
1199365739 X:146980167-146980189 CATCCTCCCAAGACTGAACCAGG - Intergenic
1199841135 X:151650624-151650646 CTTCCAGCCAAGATGGAGTGAGG + Intronic