ID: 1153622471

View in Genome Browser
Species Human (GRCh38)
Location 18:6991683-6991705
Sequence AAGAAGTAGAATTATTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 664}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153622471 Original CRISPR AAGAAGTAGAATTATTGGCT GGG (reversed) Intronic
901530848 1:9851664-9851686 AAGAAAAAGAAGGATTGGCTGGG - Intronic
901725971 1:11242337-11242359 AAAAAATACAATTATTAGCTTGG + Intronic
902035169 1:13452695-13452717 AAGAATTATAATTTTTGGCCGGG - Intergenic
902103357 1:14012453-14012475 AATAAGTAAAAACATTGGCTGGG + Intergenic
902888454 1:19423970-19423992 AAAAAATAGAAAAATTGGCTGGG - Intronic
904522068 1:31103212-31103234 AAAAAGTAGAAAAATTAGCTGGG + Intergenic
904731531 1:32595951-32595973 AAGAAGTAAAATGATGGGCCAGG - Intronic
905076562 1:35276900-35276922 AAGAAAGGGGATTATTGGCTGGG - Intronic
906160437 1:43644810-43644832 AAGAAAGAAAATTATAGGCTGGG - Intergenic
906170392 1:43720080-43720102 AAAAAATAGAATAATTGGCTAGG + Intronic
906193870 1:43916733-43916755 AAGAAATAGAATAATTAGCTGGG - Intronic
906302107 1:44690388-44690410 AAGAAATACAATTATAGGTTGGG - Intronic
906428811 1:45737619-45737641 AAAAAATAGAAAAATTGGCTGGG - Intronic
906445078 1:45889345-45889367 AAGAAGTACAAAAATTAGCTGGG - Intronic
907022586 1:51082950-51082972 AAGAATTAATATTGTTGGCTGGG - Intergenic
907543186 1:55235145-55235167 TAAAAGTTGAATTATAGGCTGGG + Intergenic
907576253 1:55528372-55528394 AAGAAGCAGGATTATTTCCTTGG - Intergenic
908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG + Intronic
908341428 1:63184042-63184064 AAAAAATACAATAATTGGCTGGG + Intergenic
908505403 1:64792905-64792927 AAGAATTGTAATTCTTGGCTGGG + Intronic
908744630 1:67363509-67363531 AAGAATAAGAATAATTGGCCGGG - Intronic
909559383 1:76992653-76992675 AAGAAATAGAAAAATTAGCTGGG - Intronic
909619832 1:77654942-77654964 AAGAAATAAATTTCTTGGCTCGG - Intronic
910271679 1:85402145-85402167 AAAAAATAGAAGTATTAGCTGGG - Intronic
910800141 1:91137185-91137207 AAAAAGTAAAAACATTGGCTGGG + Intergenic
911583016 1:99657219-99657241 AATAGGTAGAATTATCTGCTAGG - Intronic
911990561 1:104692068-104692090 AAAAAGCAAAATTATTGGCTGGG + Intergenic
912065386 1:105734039-105734061 AAGAATTATAATTTTTGGCCGGG + Intergenic
912358542 1:109075271-109075293 AAGCAGTAGGATTATTAGTTAGG - Intronic
912786446 1:112608280-112608302 AAGCACTAGAATTATAGGTTTGG + Intronic
912904314 1:113688004-113688026 AAGAAGTACAAAAATTAGCTGGG - Intergenic
913179558 1:116308399-116308421 AAGAAGCAGAATGTTTGGTTGGG - Intergenic
913359776 1:117967407-117967429 TAGAAGAAGAAGTATTGTCTTGG + Intronic
913409840 1:118539211-118539233 AAGGAGTATTATTATTGGCAAGG - Intergenic
914295293 1:146316186-146316208 AAAAAGAAAAATTATTGGCCGGG + Intergenic
914463273 1:147904226-147904248 AAAAATAAGAGTTATTGGCTGGG - Intergenic
914556334 1:148766969-148766991 AAAAAGAAAAATTATTGGCCGGG + Intergenic
914616503 1:149363264-149363286 AAAAAGAAAAATTATTGGCCGGG - Intergenic
914834162 1:151193545-151193567 AAGAGATATAATTATTGGCCAGG + Intronic
915130809 1:153694213-153694235 AAGAATTATTATTATTGGCCGGG + Intergenic
915544081 1:156586087-156586109 AAAAAGTAGAATGTGTGGCTTGG + Intronic
916038787 1:160944645-160944667 AAGAAGTACAAAAATTAGCTAGG - Intergenic
916375069 1:164144301-164144323 AAAAAGTAGAAAAATTAGCTGGG + Intergenic
916990795 1:170242720-170242742 AGGAAGTATAGTTATTGGGTAGG - Intergenic
917411385 1:174763221-174763243 AAAATGTACAATTAGTGGCTGGG + Intronic
917502095 1:175594867-175594889 AAAAAAAAAAATTATTGGCTGGG + Intronic
917828032 1:178844455-178844477 AAGAAGTAGAAATGTTTTCTCGG + Intronic
917983402 1:180289567-180289589 TAGAAGTAGAATTACTAGGTTGG - Intronic
918845232 1:189601116-189601138 TAAAACTAGAATTTTTGGCTGGG - Intergenic
919604213 1:199660893-199660915 AAGAAGAAAAAATAATGGCTAGG + Intergenic
920391053 1:205601876-205601898 AAGATGTAAAATTTTTGGCTGGG - Exonic
920798805 1:209167683-209167705 AAAAATTATTATTATTGGCTGGG - Intergenic
921117077 1:212102268-212102290 AAAAAATAGAAATTTTGGCTAGG - Intronic
921553143 1:216563892-216563914 AAAAAGTAGAAGTATTTGCTAGG + Intronic
921619988 1:217314757-217314779 AAGAAGTTGTAGTGTTGGCTGGG + Intergenic
921660178 1:217792008-217792030 AAGAAGAAGAAGAATTGTCTTGG + Intronic
923031538 1:230252768-230252790 AAGATTTAGAATTAGGGGCTAGG - Intronic
923077422 1:230622580-230622602 AAGAAGTACCATTATTAACTTGG + Intergenic
923169866 1:231405470-231405492 AAAAAGTAGTTATATTGGCTGGG - Intronic
923907711 1:238403817-238403839 CACAATTAGAATTATTTGCTGGG - Intergenic
924497893 1:244607816-244607838 AAGAATTAAACTTGTTGGCTAGG + Intronic
924716217 1:246576787-246576809 AAGAAATATAATTTGTGGCTGGG - Intronic
924718006 1:246596252-246596274 AAAAAGTAAAATAATTAGCTGGG + Intronic
924810351 1:247395596-247395618 AAAAGAAAGAATTATTGGCTGGG - Intergenic
1063024055 10:2160494-2160516 GAGAATTAGAATTATTGGGCTGG + Intergenic
1063983588 10:11477165-11477187 ATAAAGTCGAATTCTTGGCTGGG - Intronic
1064667475 10:17670217-17670239 AAAAAGTAAAATCATTGTCTAGG - Intronic
1064718887 10:18207332-18207354 AAATAGAACAATTATTGGCTGGG - Intronic
1066084932 10:31967059-31967081 AAGAAGAAGGAATACTGGCTGGG - Intergenic
1066367241 10:34788972-34788994 CTGAAGTATAATTATTGGATAGG - Intronic
1066405019 10:35110209-35110231 AGGAGGTATAATTGTTGGCTAGG + Intergenic
1066405176 10:35111551-35111573 TCAAATTAGAATTATTGGCTGGG - Intergenic
1067097484 10:43312017-43312039 AAGAAATATCACTATTGGCTGGG + Intergenic
1067305408 10:45059733-45059755 AAAAAGTAGAAAAATTTGCTGGG - Intergenic
1067598485 10:47578018-47578040 AAGAAAAAGAATGCTTGGCTGGG + Intergenic
1068032101 10:51716991-51717013 AAAAAGCAATATTATTGGCTGGG - Intronic
1069649270 10:70032443-70032465 AAAAAATAAAATTATTGGCTGGG + Intergenic
1070211864 10:74331779-74331801 AAGAAATATAAATGTTGGCTGGG - Intronic
1071201716 10:83227005-83227027 AAGAAGGAGAATTTGTGGCACGG - Intergenic
1072726923 10:97820021-97820043 AAAAAGTAGAAGAATTAGCTGGG + Intergenic
1073319683 10:102607342-102607364 CAGAATTACTATTATTGGCTGGG - Intronic
1073325025 10:102638796-102638818 AAAAAGTACAAAAATTGGCTGGG + Intergenic
1073737360 10:106364644-106364666 AAGAAATAGTATTATTGGAATGG + Intergenic
1074744154 10:116514908-116514930 AAGGAGAGGAAGTATTGGCTGGG + Intergenic
1075149271 10:119912291-119912313 AAAAAATAGAAATATTAGCTGGG - Intronic
1075856828 10:125637004-125637026 GATAAGTAGAATTATAGGCCTGG + Intronic
1076236903 10:128870616-128870638 AATAATAATAATTATTGGCTGGG - Intergenic
1076443856 10:130498565-130498587 AACAAGTAGAATTAATCTCTGGG + Intergenic
1076575904 10:131467510-131467532 TAAAAATAGTATTATTGGCTGGG - Intergenic
1077794236 11:5474666-5474688 GAGAAATAGAATTATTGCATTGG - Intronic
1078049859 11:7954334-7954356 AAGATTAAGAATTGTTGGCTGGG + Intergenic
1078196006 11:9137788-9137810 AGGAAGTGGGATTCTTGGCTGGG - Intronic
1078376555 11:10799043-10799065 AAGAAGAAGCTTTCTTGGCTTGG - Exonic
1079046826 11:17112154-17112176 AACACGTAAAATTTTTGGCTGGG + Intronic
1079223357 11:18584081-18584103 AAGGAATATACTTATTGGCTGGG + Intronic
1079384572 11:19967467-19967489 AGAAAGTACAAATATTGGCTTGG + Intronic
1079441467 11:20518931-20518953 GAAAAGAAAAATTATTGGCTGGG + Intergenic
1080007553 11:27425749-27425771 AAGAGGTGGAATTTTTGGTTTGG + Intronic
1080010531 11:27454462-27454484 AATAAATAAAATTATTGGCCGGG + Intronic
1080498383 11:32844871-32844893 AAGAAATACAAATATTGGATGGG - Intronic
1081722146 11:45298123-45298145 AAAAAGTATAAATATTGGATGGG + Intergenic
1082738443 11:56883414-56883436 AAGAAATAAAGTTACTGGCTGGG - Intergenic
1082809479 11:57470540-57470562 AATAAGGATTATTATTGGCTGGG - Intronic
1083237096 11:61358119-61358141 AAGTATTAGAATTCTTCGCTGGG + Intronic
1083349944 11:62020534-62020556 AAAAAGTACAATAATTAGCTAGG + Intergenic
1083938321 11:65881942-65881964 AAAAAGTAGAAAAATTAGCTGGG - Intronic
1084771784 11:71347768-71347790 AAGAAGGAGAAAGAATGGCTTGG + Intergenic
1084923502 11:72492520-72492542 AAGAAAAAAAATGATTGGCTGGG + Intergenic
1084994733 11:72965082-72965104 AAGAAGTAAAATGATTGGCCAGG - Intronic
1085671420 11:78468050-78468072 AAAAAAAAGAATTCTTGGCTGGG + Intronic
1086977478 11:93152096-93152118 AAGAAGTGGACTTATCAGCTTGG - Intronic
1087587481 11:100140683-100140705 GAGAAGTAGAATAATTATCTGGG + Intronic
1087747774 11:101969314-101969336 AAAAAGTATCATTGTTGGCTGGG - Intronic
1087859132 11:103131879-103131901 CAGAAGTTTAATTATTGTCTAGG + Intronic
1088078457 11:105880036-105880058 AAGATGTAGAATTATTAGAAGGG - Intronic
1088330047 11:108642041-108642063 AAGAAATTGAATCATTGGCCTGG + Intergenic
1088642668 11:111888364-111888386 TTAAATTAGAATTATTGGCTAGG - Intergenic
1089020742 11:115211782-115211804 CAGAAATAGGATTATAGGCTGGG - Intronic
1089066174 11:115663770-115663792 AAGAAATAGAATAATGGGTTTGG - Intergenic
1089524513 11:119088170-119088192 AAGAACCAGAATCACTGGCTTGG - Intronic
1089568182 11:119383627-119383649 TAGAAGAAGAATTATTGTTTTGG + Intergenic
1089614621 11:119688271-119688293 AAGCAGTTGTATTATTTGCTAGG + Intronic
1089761840 11:120732424-120732446 AAGAACTAGAAAAGTTGGCTGGG - Intronic
1089894288 11:121913034-121913056 AAGAAGTTAAATTATTTGCAAGG + Intergenic
1089977285 11:122743373-122743395 AAGAAGTAAAAAAATTAGCTAGG - Intronic
1089986571 11:122819566-122819588 AATACTTAGAATTATTGGTTAGG + Intergenic
1091636255 12:2199145-2199167 AGGAAGTATAATTCGTGGCTGGG - Intronic
1092362422 12:7848525-7848547 AAAAAGCAGAATTTGTGGCTAGG - Intronic
1092378844 12:7978420-7978442 AAGAAGCAAAAATTTTGGCTAGG - Intergenic
1092796012 12:12110851-12110873 AATAAGTAGATTTTTTGGCCAGG + Intronic
1093029696 12:14276822-14276844 AAGAAGTAAAAACATTAGCTGGG - Intergenic
1094444791 12:30518030-30518052 AAAAAGTAGAAAAATTAGCTGGG + Intergenic
1094458401 12:30665033-30665055 AAGAAAAAGATTTATAGGCTGGG - Intronic
1095159166 12:38896169-38896191 AATAAATAGAAATATTTGCTGGG + Intronic
1095211933 12:39504420-39504442 AAGAAGTAGCATGATTGGCCAGG - Intergenic
1095415312 12:41970300-41970322 AAGAAATAGAATTATTAACATGG + Intergenic
1095589424 12:43887213-43887235 AAGAAGCAGAAGTACTGCCTGGG + Intronic
1096025786 12:48359808-48359830 AATTAGTAGAATTTGTGGCTAGG - Intergenic
1096699102 12:53370770-53370792 AAGAAGTAGAATTGTAGTCAGGG + Intergenic
1097475362 12:60048454-60048476 AAGACTTAGAATTAGTGGCTTGG + Intergenic
1097545321 12:60993031-60993053 AAGAATTAAAATTATTGACAAGG - Intergenic
1097649384 12:62277641-62277663 CAGAAGAAGAATTATTGTCTTGG + Intronic
1097864511 12:64548483-64548505 AAGAAGTAAAATTGTTGGCCAGG - Intergenic
1098273284 12:68789762-68789784 AAAAATTATGATTATTGGCTGGG + Intronic
1098382393 12:69882629-69882651 AAAATGTAGAATTACTGGGTTGG + Intronic
1098439862 12:70505965-70505987 AAAAAGTAGTACTGTTGGCTGGG + Intergenic
1100358235 12:93852048-93852070 AAGATAATGAATTATTGGCTGGG - Intronic
1100442803 12:94632352-94632374 GAGATGTAAAATTATTGACTAGG + Intronic
1100779344 12:98007702-98007724 AAGAAGTAGAAGCACTGGCTGGG + Intergenic
1100827679 12:98490076-98490098 AAAAAATAAAATTTTTGGCTGGG - Intronic
1101090789 12:101282875-101282897 AGGAAGTAGAATGAATGGATAGG + Intronic
1101360218 12:104019421-104019443 CAGAAGTGGACTTATCGGCTGGG - Intronic
1101882142 12:108632809-108632831 AATAATTAGAATATTTGGCTGGG - Intronic
1102118134 12:110419265-110419287 AAAAAAAAGAATTATTGGCTGGG - Intergenic
1102641681 12:114372463-114372485 AAAAAATACAACTATTGGCTGGG - Intronic
1103609655 12:122115040-122115062 AAGAAGTAGTCTTCCTGGCTGGG - Intronic
1104003636 12:124876863-124876885 AAAAAGTAGAATTGGAGGCTGGG + Intronic
1104122164 12:125809953-125809975 AAGAAGTAGAATTATTCTGTGGG + Intergenic
1104407371 12:128529275-128529297 AAGATCTAGATTTAATGGCTAGG - Intronic
1104855151 12:131898298-131898320 TAGAAGTAGAATCCTTGGGTAGG + Intronic
1105721850 13:23124310-23124332 AAGAAATAATGTTATTGGCTGGG - Intergenic
1105909307 13:24846635-24846657 TGGAAGAAGAATTATTGTCTTGG + Intronic
1106914026 13:34492941-34492963 AAGAAATAGAAAAATCGGCTGGG + Intergenic
1107198739 13:37687256-37687278 AAGAAGTAGAACTTTGGGCTGGG - Intronic
1107401107 13:40070204-40070226 AAGAAATAAAATTATTCACTTGG - Intergenic
1107524775 13:41219701-41219723 AAGAAGGAGTATTAGAGGCTGGG + Intronic
1108276090 13:48811175-48811197 AAGAAAAAGAACAATTGGCTAGG + Intergenic
1108863344 13:54890358-54890380 AAAAAGTACAAATATTAGCTGGG + Intergenic
1108900339 13:55396437-55396459 AAGAAGTAAAATATATGGCTTGG - Intergenic
1109296150 13:60533343-60533365 AAGAGATACTATTATTGGCTGGG + Intronic
1109648554 13:65293346-65293368 AAGATGTAGAATTAGTGAGTAGG - Intergenic
1110088325 13:71411121-71411143 AAGAAGTGGAAATATTGGGAAGG - Intergenic
1110199813 13:72835802-72835824 AAGAAATATCATTTTTGGCTGGG + Intronic
1111285409 13:86084938-86084960 AAGGACTAGAATTAGTGGGTTGG - Intergenic
1111540733 13:89664302-89664324 AATAAGTAAAATTGTTGGCTAGG - Intergenic
1112090960 13:96083670-96083692 TAGGAGTGGAATTAATGGCTAGG + Intergenic
1112269251 13:97953171-97953193 AATAATTATAAATATTGGCTGGG - Intergenic
1112352681 13:98649751-98649773 AAGAAGTGTGATTGTTGGCTGGG - Intergenic
1112454017 13:99541852-99541874 AAGAATTAATATTCTTGGCTGGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114171321 14:20274694-20274716 AAGAAGTCAAACTATTGGGTTGG + Intronic
1114630484 14:24156482-24156504 AAGAAGTGTAATATTTGGCTAGG + Intronic
1114815873 14:25957266-25957288 AAGAAGTGTGATTATTGGCCTGG + Intergenic
1115494428 14:33988304-33988326 AAGAAGTAAAATGAATGGCAAGG + Intronic
1115930566 14:38487754-38487776 AAAAATTAAAATAATTGGCTGGG + Intergenic
1117563757 14:56972036-56972058 AAGAAGCATAAATATTGGGTAGG - Intergenic
1117712680 14:58548586-58548608 AGGGAGTAGAATTGTTGGCTGGG + Intronic
1117873330 14:60223240-60223262 AAGAAGTAAAATTACTAGGTTGG - Intergenic
1117976402 14:61301194-61301216 ATGAAGTAGAGTCATTGTCTGGG - Intronic
1118899559 14:69975046-69975068 AAGGATTAGAATTTTTGACTGGG + Intronic
1119315005 14:73686408-73686430 AGGAAATTGTATTATTGGCTGGG + Intronic
1119457950 14:74772650-74772672 AGAATGTAGAACTATTGGCTGGG - Intronic
1119493860 14:75062133-75062155 AAGAAAAAGAGGTATTGGCTGGG + Intronic
1119719388 14:76881015-76881037 ACGAAGTACAAAAATTGGCTGGG + Intergenic
1119912665 14:78364239-78364261 AAGAAGTAGAACTCTGGCCTTGG + Intronic
1120066989 14:80053945-80053967 TAGAAGAAGAATAATTGTCTTGG + Intergenic
1120724845 14:87927126-87927148 AAGAAATAGAAAAATTGGCCAGG + Intronic
1121082735 14:91121391-91121413 AAGAAATAATATTTTTGGCTGGG + Intronic
1123987849 15:25660532-25660554 AGGAATTAAAATTATAGGCTGGG + Intergenic
1124474907 15:30024866-30024888 AAAAAATAGACTTATTGGCCAGG + Intergenic
1124961568 15:34400521-34400543 AAGAAATAGAACCTTTGGCTGGG - Intronic
1124978194 15:34546744-34546766 AAGAAATAGAACCTTTGGCTGGG - Intronic
1125438790 15:39678017-39678039 ACGAAGTATAATTATTGACAAGG + Intronic
1125693034 15:41612097-41612119 AAGAATAAAAATCATTGGCTGGG + Intergenic
1126759804 15:51959297-51959319 AAGAAGTAAAATTACTGGCCGGG - Intronic
1127079340 15:55361410-55361432 AAAAGGTAAAATTATTAGCTGGG + Intronic
1128155249 15:65387948-65387970 AAAAAATACAATAATTGGCTGGG + Intronic
1129130826 15:73493177-73493199 AAAAATTAGAAATATTAGCTGGG - Intronic
1129557365 15:76526651-76526673 TGGAAGTAGAATTAATAGCTTGG - Intronic
1130171073 15:81514644-81514666 AAGATGTAGAAGAATTAGCTGGG + Intergenic
1130204046 15:81859497-81859519 AAAAAATATAAGTATTGGCTGGG - Intergenic
1130266491 15:82409697-82409719 AAGAAATAGAACCTTTGGCTGGG + Intergenic
1130449252 15:84034353-84034375 AAGGAGTAGCATTAGTGGCGTGG + Intronic
1130533378 15:84765094-84765116 AAGAAGTAGAATTGGTTGCCAGG - Intronic
1131331115 15:91500350-91500372 AAGAATTAAAATTTTTGGCCGGG + Intergenic
1131416241 15:92261336-92261358 AAGGAGTGAAATTCTTGGCTGGG + Intergenic
1131626266 15:94123935-94123957 AAGAAGTAGAGTTTTGGGCGAGG - Intergenic
1131686943 15:94778585-94778607 AAAAAGTAGAGTTGCTGGCTTGG + Intergenic
1131818405 15:96246407-96246429 AAGAAGTAGAATTAGAACCTGGG - Intergenic
1132012106 15:98285148-98285170 AAGAAGTAGAATTAATGGTTGGG + Intergenic
1132637134 16:956546-956568 AAAAAGTAGATTTAAGGGCTGGG + Intronic
1133083971 16:3347084-3347106 AAGAAGTACAAAAATTAGCTGGG + Intergenic
1133542407 16:6769020-6769042 AAAAAGAAGTAATATTGGCTGGG - Intronic
1133799327 16:9072311-9072333 AAAAAGTACAAAAATTGGCTAGG - Intergenic
1134283969 16:12843932-12843954 AAAAAGATGAAGTATTGGCTGGG - Intergenic
1134533271 16:15002225-15002247 AATAAGTAAAATTATTCTCTTGG + Intronic
1134910202 16:18018984-18019006 AAGAAATGCAATTATTGGCCAGG + Intergenic
1135263967 16:21005537-21005559 AAAAAATAAAATTATTTGCTGGG - Intronic
1135496344 16:22954907-22954929 TAAAAGTAAAGTTATTGGCTGGG + Intergenic
1135723479 16:24836449-24836471 AAGAATTATATTTATTAGCTGGG + Intergenic
1136041869 16:27585804-27585826 AAAAAGTAGAAAGAATGGCTGGG + Intronic
1136225038 16:28854593-28854615 AAGAAATAGAAAAATTAGCTGGG + Intronic
1136401055 16:30019020-30019042 AAGAGGTTGAAGAATTGGCTGGG + Intronic
1136471125 16:30481004-30481026 AAGAAGTAGAGTTTGGGGCTGGG + Intronic
1136604254 16:31322154-31322176 TAAAAGTAAAATTATTAGCTAGG + Intronic
1137421584 16:48339455-48339477 AGGAAGTAGAATTAGTGTGTAGG + Intronic
1137923766 16:52519660-52519682 AAGAAGTAGTAGAATGGGCTGGG + Intronic
1137975829 16:53031007-53031029 TAAAAGTATAATTATTGGCCAGG - Intergenic
1138001285 16:53282443-53282465 AAAAAGTAGAAAAATTGGCTAGG + Intronic
1138316488 16:56074287-56074309 AAGAAGCAGAGTTATTGGCTGGG - Intergenic
1138465047 16:57183626-57183648 AAGAATTAATATTTTTGGCTGGG - Intronic
1139921876 16:70465648-70465670 AAAAAATAAAATTATAGGCTGGG + Intronic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140391395 16:74590292-74590314 AAAAAGAAAAATTATCGGCTAGG - Intronic
1140497398 16:75401131-75401153 AAGAAATACAAAAATTGGCTGGG + Intronic
1140577137 16:76183916-76183938 AAGAAGCAGAATGTTTGGTTTGG + Intergenic
1140863037 16:79035888-79035910 AAGAAGCTGAATTCTTGGCTGGG - Intronic
1140879105 16:79181734-79181756 TAGAAGTGGAATTACTGGGTCGG + Intronic
1142843047 17:2648962-2648984 AAGAATTAGAACTATTGGAAAGG + Intronic
1143018937 17:3906424-3906446 AAGAAGTACCATTGTTGGCCGGG - Intronic
1143230658 17:5351639-5351661 AATAAGAAGAATAATTAGCTGGG + Intronic
1143612994 17:8030875-8030897 AAAAAAAAAAATTATTGGCTGGG - Intergenic
1143989385 17:10943798-10943820 AAGAAATAGAAAAATTAGCTGGG + Intergenic
1144704634 17:17359459-17359481 AAAAAGTAGCAAAATTGGCTGGG + Intergenic
1145082186 17:19903197-19903219 AAGAAAAAGAATTTTGGGCTAGG - Intergenic
1145259436 17:21345943-21345965 AAGAAGTGCAATTTCTGGCTGGG - Intergenic
1145317181 17:21742005-21742027 AAGAAGTGCAATTTCTGGCTGGG + Intergenic
1146316132 17:31808522-31808544 AAGAAGTACAAAAATGGGCTGGG - Intergenic
1146509339 17:33432353-33432375 AAAAAGTACAAAAATTGGCTGGG + Intronic
1146787159 17:35730699-35730721 AAGAAGTAGATTTTGGGGCTGGG - Intronic
1147009791 17:37436072-37436094 GGGAAGTATAATTTTTGGCTTGG - Intronic
1147468955 17:40638983-40639005 AAGAAGTAGAGTTATAGGGATGG - Intronic
1147734818 17:42629304-42629326 CAGAATTAAAATTAATGGCTGGG - Intergenic
1147927935 17:43956665-43956687 GACAAGGAGAATTGTTGGCTGGG - Intronic
1148029777 17:44611571-44611593 AAAAACTTGTATTATTGGCTGGG - Intergenic
1148898476 17:50855388-50855410 AAGAAATGGAATTACTGGCCGGG - Intergenic
1149028420 17:52056624-52056646 AAGAAGTAGAATTCCTGGTTGGG + Intronic
1149727249 17:58908733-58908755 AAGAAGTATAAAAAGTGGCTCGG - Intronic
1149831917 17:59879911-59879933 TAGAAATACAATTATTAGCTGGG - Intronic
1149886466 17:60344748-60344770 AAGAATAAAATTTATTGGCTGGG - Intronic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1151736998 17:75949153-75949175 AAGAAAAATAATTGTTGGCTGGG - Intronic
1151845158 17:76648538-76648560 AAGAAGTACAAAAATTAGCTGGG + Intergenic
1152026374 17:77812035-77812057 GAGAAGTAGAATGATTTGCAGGG - Intergenic
1153232924 18:2957538-2957560 AAGAGATATATTTATTGGCTTGG - Intronic
1153622471 18:6991683-6991705 AAGAAGTAGAATTATTGGCTGGG - Intronic
1153732358 18:8027823-8027845 AAGAAGTAGAATTTATCACTGGG + Intronic
1155579538 18:27287543-27287565 AAGAATTAAAATTTTGGGCTTGG + Intergenic
1155698448 18:28713054-28713076 AAGAATGAGTATTATTGGTTTGG - Intergenic
1156119773 18:33828611-33828633 AAGAAGCATAATTATTGGAAAGG - Intergenic
1157249641 18:46083277-46083299 AAAAAGTAGAAAAATTGGCTGGG + Exonic
1157725898 18:49963585-49963607 AAAAAGTAGAAAAATTAGCTCGG - Intronic
1157805231 18:50652887-50652909 ATGAATAAGAATTAGTGGCTGGG + Intronic
1158597078 18:58826003-58826025 AAGAAGTAAAAAAATTAGCTGGG - Intergenic
1159254466 18:65928615-65928637 TCAAAGTAGAATTTTTGGCTGGG + Intergenic
1159610214 18:70516605-70516627 ATAAAGAAGAAGTATTGGCTGGG + Intergenic
1159657576 18:71050993-71051015 AAGAATTAAGATAATTGGCTGGG + Intergenic
1159983520 18:74814292-74814314 AAAAAGTAAAATCATTAGCTGGG - Intronic
1159986423 18:74846831-74846853 AAAAAGTAGAAAAATTAGCTGGG + Intronic
1160054924 18:75470093-75470115 ATGAAATAGAATGAATGGCTTGG + Intergenic
1160139859 18:76311785-76311807 CAGAAGTCGAATTGTTGGTTGGG + Intergenic
1161914268 19:7216970-7216992 AAGAAGAAGAAAAATTAGCTGGG - Intronic
1163543736 19:17928206-17928228 AAAAAGTAGAAAAATTGGCTGGG + Intergenic
1163543778 19:17928472-17928494 AAAAAGTAGAAAAATTGGCTGGG + Intergenic
1164185180 19:22860232-22860254 AAAAAGAAAAAATATTGGCTGGG + Intergenic
1164510912 19:28896626-28896648 AAGAAGTAGAAATATTGAAAAGG - Intergenic
1164638557 19:29808880-29808902 AATAATAATAATTATTGGCTGGG + Intergenic
1165355455 19:35301027-35301049 AAAAAATAGAAAAATTGGCTGGG - Intronic
1165763277 19:38335221-38335243 AAGGAGTAGAATTTTGGGGTAGG + Intergenic
1165764223 19:38340613-38340635 AAAAAATAAAATTATTGGCCGGG - Intronic
1166378491 19:42342341-42342363 AAAAAGGAGAATTTCTGGCTGGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166514354 19:43434966-43434988 AAAAATTAGCTTTATTGGCTGGG - Intergenic
1166834636 19:45659778-45659800 AAAAAGTACAAAAATTGGCTGGG + Intergenic
1167839661 19:52105026-52105048 AATAATTATAATTGTTGGCTGGG + Intergenic
1167864439 19:52313114-52313136 AAGAGAAAGAATTATAGGCTGGG - Intronic
1168143726 19:54407179-54407201 TAAAAGTAGAATTGTTGGCCGGG + Intergenic
1168374060 19:55860730-55860752 AAGATGTCGACTTAATGGCTGGG + Intronic
1168535048 19:57162049-57162071 AAAAAGTAGAAAAATTAGCTGGG - Intronic
925261316 2:2530884-2530906 AAAAGGTAAAATAATTGGCTCGG + Intergenic
925372779 2:3359673-3359695 AAGAGGTAGAATTATACACTTGG - Intronic
925714083 2:6768772-6768794 TGGAAGAAGAATTATTGTCTTGG + Intergenic
925883551 2:8373016-8373038 AAGAAATAGTATTATGGGCAGGG + Intergenic
926169441 2:10542717-10542739 AAGAATTACATTTTTTGGCTGGG - Intergenic
926900739 2:17749392-17749414 AAGAAGAAAAATTAATGGCCGGG + Intronic
928318390 2:30263818-30263840 AAGAAAAAGAAATGTTGGCTGGG + Intronic
928350973 2:30554088-30554110 AAGATTTAGAAACATTGGCTTGG + Intronic
929850234 2:45580976-45580998 AAGAAGTAGAAGAATTGGCTGGG - Intronic
930309090 2:49714980-49715002 AAGCAGTATAAATATTGGCAAGG - Intergenic
930502956 2:52246047-52246069 AAAAACTATAATTGTTGGCTAGG + Intergenic
931145016 2:59507984-59508006 AAAAAGTGGTTTTATTGGCTGGG + Intergenic
931260392 2:60613257-60613279 TAAAAATAGAATTATTGGCCAGG + Intergenic
931278466 2:60765374-60765396 AAAAAAGAGAATTATAGGCTGGG - Intronic
931360390 2:61573011-61573033 AAGAAAAAGATTTATTGGCAGGG - Intergenic
931731219 2:65155103-65155125 AAAAAGGAGAATTATGGGCTGGG - Intergenic
931740096 2:65234205-65234227 AAGAACTAAAATAATTGGCTGGG - Intronic
932837889 2:75054365-75054387 TAGAACTAGAATTAGTGGGTGGG + Intronic
932896546 2:75646164-75646186 AAGAATTAGAAAAATTAGCTGGG + Intergenic
933007589 2:77015484-77015506 TAGAAGTACAAAAATTGGCTGGG - Intronic
933476762 2:82801689-82801711 AAGAAGTATACATTTTGGCTTGG + Intergenic
933680670 2:85097221-85097243 TAGTAGCAGAATTATTGCCTAGG + Intergenic
933761868 2:85678115-85678137 GAGAAGTAGAATGATTGTCAGGG - Intergenic
933884981 2:86711064-86711086 AAGAAGAAGAATTATTAAATAGG - Intronic
933925193 2:87085623-87085645 AAGAAGAAGAATTATTAAATAGG + Intergenic
934770691 2:96906177-96906199 AAAAAGAAAAAGTATTGGCTGGG - Intronic
935002217 2:99030049-99030071 AAAAATTAAAATTGTTGGCTGGG + Intronic
935002266 2:99030350-99030372 AAAAATTAAAATTATTGGCTGGG + Intronic
935104868 2:100032057-100032079 AACAAGTAGACTTATAGTCTTGG + Intronic
935674874 2:105585990-105586012 AAAAAGTAGAAAAATTAGCTGGG + Intergenic
936370985 2:111902178-111902200 TAAAAATATAATTATTGGCTGGG - Intronic
936646151 2:114375292-114375314 AAGAAGTAACAGTGTTGGCTGGG - Intergenic
936764482 2:115830195-115830217 AAAAAGTACAAAAATTGGCTGGG + Intronic
937293352 2:120795224-120795246 AAAAAGAAAAATTCTTGGCTGGG + Intronic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
938395771 2:130946805-130946827 AAGAAAGGGAATTATTGGCTGGG + Intronic
939452721 2:142394815-142394837 AAAAAGTAGAGATACTGGCTGGG - Intergenic
939780104 2:146435548-146435570 AAGAAAAAAAATTATTGGCTGGG + Intergenic
939811052 2:146832626-146832648 ATCAAGAAGAATTATGGGCTGGG - Intergenic
940789120 2:158013289-158013311 ATGAAAAAGAATTATTGGCCAGG - Intronic
941093991 2:161214347-161214369 CTGAAGTACAATTATTGTCTTGG - Intronic
942220951 2:173768449-173768471 AATAATTATTATTATTGGCTGGG + Intergenic
942284552 2:174402390-174402412 TAGATGGAAAATTATTGGCTGGG + Intronic
942503501 2:176617257-176617279 AATAAAAATAATTATTGGCTGGG + Intergenic
943151689 2:184121932-184121954 AAGAAGTAGAAATTTTTGTTGGG + Intergenic
943305016 2:186250137-186250159 AAGATGTAGAATATTTGGCCAGG + Intergenic
944091781 2:195919638-195919660 AAAAAGTAGACTTTTTGGCCTGG - Intronic
944548896 2:200827222-200827244 CAGCAATAGAATTACTGGCTTGG - Intergenic
944652721 2:201847848-201847870 AAGACATAGAATTTTTAGCTGGG + Intronic
945015218 2:205508122-205508144 AAGCAGTAGAATTATTTGAAAGG + Intronic
945086042 2:206133680-206133702 AAGATGTAAAGTTATAGGCTGGG + Intronic
946828205 2:223700863-223700885 AAAAGGTAGAAATATTGGCTGGG + Intergenic
947207567 2:227675849-227675871 AATAAGAAGTATTCTTGGCTGGG + Intergenic
947950850 2:234145964-234145986 AAGAGGTCTAACTATTGGCTGGG + Intergenic
1169090086 20:2854633-2854655 AAGAAATAGAAAAATTAGCTGGG + Intronic
1169096434 20:2903389-2903411 AAGAAATAGAATTATTGGCTGGG + Intronic
1169302745 20:4458515-4458537 AAGGAGTAGAATATTTGGATTGG - Intergenic
1170301872 20:14892972-14892994 AGAAAGTAGAATCATGGGCTGGG - Intronic
1170496293 20:16928671-16928693 AAGAAGAATAATTATTACCTGGG - Intergenic
1170738712 20:19033838-19033860 AAGAAATACAAAAATTGGCTAGG + Intergenic
1170839940 20:19916456-19916478 AAGAAATAAAAATATTAGCTGGG + Intronic
1172154585 20:32814897-32814919 AAAAAGAAGAAGAATTGGCTGGG + Intergenic
1172238162 20:33392528-33392550 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1172561739 20:35895011-35895033 AAGAAGAAGAAAAATTAGCTGGG - Intronic
1172681751 20:36721233-36721255 AAGAAATAGATTTTTTGGCCTGG + Intronic
1172834914 20:37867096-37867118 CAGAAGTAGAATATTTTGCTAGG - Intronic
1174001269 20:47376554-47376576 AAGAAGAAGAAATCTAGGCTAGG + Intergenic
1174417271 20:50375934-50375956 AAAAAGTAGAAAAATTAGCTGGG - Intergenic
1174605033 20:51755140-51755162 AATAAATAAATTTATTGGCTGGG + Intronic
1174818807 20:53710001-53710023 AAAAAATAGAATTCTGGGCTGGG - Intergenic
1174935510 20:54863865-54863887 AAAAAGTTGAACTATGGGCTGGG + Intergenic
1175262858 20:57685698-57685720 AAGAGCCAGAATTATTTGCTGGG - Intronic
1176136821 20:63526702-63526724 AAGAAGGAAATTTGTTGGCTGGG + Intergenic
1176453498 21:6885534-6885556 AAAAAATAGAAGCATTGGCTTGG + Intergenic
1176831673 21:13750582-13750604 AAAAAATAGAAGCATTGGCTTGG + Intergenic
1177137697 21:17323933-17323955 AAGAATCAGTATTGTTGGCTGGG + Intergenic
1177151624 21:17460984-17461006 AAGACGTAGAATTAATGGAAAGG - Intergenic
1177624574 21:23644117-23644139 AAGAAGTTAAATTGTTGTCTTGG - Intergenic
1178194892 21:30333359-30333381 AAGAAGTACAAATATTAGCCAGG + Intergenic
1178465440 21:32843436-32843458 AAAAGGTATTATTATTGGCTGGG - Intergenic
1178483611 21:33002873-33002895 AAGAGTTCAAATTATTGGCTGGG - Intergenic
1178586865 21:33878189-33878211 AAAAAATAGAATCATTAGCTGGG - Intronic
1178634609 21:34291200-34291222 AGGAAGTTGTGTTATTGGCTGGG + Intergenic
1178988625 21:37332316-37332338 AAGAAGAAGAATAAATAGCTGGG - Intergenic
1182638212 22:31746088-31746110 AAGAAATAAAAATATTTGCTGGG - Intronic
1182932036 22:34183605-34183627 AAGAGGCAAAATTATTGTCTAGG + Intergenic
1183424163 22:37729374-37729396 AAAAAGTAGAAAAATTAGCTGGG - Intronic
1183556102 22:38528475-38528497 ATAAAGGATAATTATTGGCTGGG + Intronic
1183798453 22:40140934-40140956 TAAAAATATAATTATTGGCTGGG - Intronic
1184044780 22:41966167-41966189 AAAAAGAAGAAATATTAGCTGGG + Intergenic
1184213279 22:43049796-43049818 AAAAAAAAGAATTGTTGGCTGGG + Intronic
1184698529 22:46152923-46152945 AAAAAATAGAAATATTGCCTGGG + Intronic
949308106 3:2666186-2666208 AGGAAGCATATTTATTGGCTTGG - Intronic
949494337 3:4617686-4617708 AAAAAATTGAAATATTGGCTGGG + Intronic
949574354 3:5324342-5324364 AAGAGTTATACTTATTGGCTGGG - Intergenic
950280087 3:11699650-11699672 AAGAAATAGAAAAATTAGCTAGG + Intronic
950800336 3:15546087-15546109 AAAAAGTAGAAAAACTGGCTGGG - Intergenic
950961049 3:17108212-17108234 AAGAAGTACAAAAATTAGCTGGG - Intergenic
951831076 3:26927992-26928014 AAAAAGTAGTAATCTTGGCTGGG - Intergenic
951852308 3:27155206-27155228 AAAAAGTACAAATACTGGCTGGG + Intronic
952694301 3:36247910-36247932 AAGAATCAGAATGACTGGCTGGG - Intergenic
952713548 3:36455246-36455268 AAGAAATAGAAATATTGCCCAGG + Intronic
952795143 3:37232703-37232725 AAAAAATGAAATTATTGGCTGGG - Intergenic
954252221 3:49376831-49376853 AAGAAACAGCATTCTTGGCTGGG + Intronic
954276661 3:49546530-49546552 AAGAAACAGCATTCTTGGCTGGG - Intergenic
954551997 3:51489491-51489513 AAGAAAAAGAAATATAGGCTGGG + Intronic
954737466 3:52718173-52718195 TAGAAATACAATTATAGGCTGGG + Intronic
954884866 3:53863981-53864003 AAAAAGTACAAATATTAGCTGGG - Intronic
954909712 3:54093524-54093546 AAGCAATAGAATTAGTGGCCGGG - Intergenic
955577062 3:60377450-60377472 AAAAAAAAGAATTCTTGGCTGGG - Intronic
955603311 3:60671642-60671664 AACATTTAGAATTATTGGCCGGG + Intronic
955893833 3:63677910-63677932 AAGAAGTAGAAAGAAAGGCTTGG - Intronic
956003081 3:64749715-64749737 AGGAAATAGAAATGTTGGCTTGG - Intergenic
957199213 3:77110852-77110874 AAAAAGTACAAAAATTGGCTGGG - Intronic
957691592 3:83577859-83577881 AAAAAGTATTATTATAGGCTGGG + Intergenic
959066891 3:101666724-101666746 AATAAATAAAAATATTGGCTTGG - Intronic
959685078 3:109136229-109136251 AAAAATAATAATTATTGGCTGGG - Intergenic
960031796 3:113061310-113061332 AAAAAGTAAAATTAGAGGCTGGG - Intergenic
960079724 3:113528449-113528471 ACAAAGTAGAATTATTTCCTTGG - Intergenic
960374458 3:116881284-116881306 AAGAATTAAAATTATAGGCTAGG + Intronic
960735603 3:120776372-120776394 AAGAAGAAAAATTAATGTCTTGG - Intronic
960995966 3:123340411-123340433 AAGAAGTATTATTCTGGGCTTGG - Intronic
961762343 3:129180942-129180964 GACAAGTAGAATTGTTGGCAAGG + Intronic
961855293 3:129864492-129864514 AAGAATTATAACTACTGGCTGGG + Intronic
962288609 3:134109858-134109880 AGGAAATTGAATTCTTGGCTGGG - Intronic
962471092 3:135710007-135710029 AAGAAGTTAAATTAATGGCCTGG + Intergenic
963017793 3:140842196-140842218 AAAATCTAGAATTACTGGCTGGG - Intergenic
963094188 3:141517948-141517970 AAGAAATATATTTATTGGCCGGG - Intronic
963192332 3:142486818-142486840 AATAATTATTATTATTGGCTGGG + Intronic
963789089 3:149565025-149565047 AAAAAGTACAAAAATTGGCTGGG + Intronic
964335477 3:155649681-155649703 AAGAAGTAGAATTAATGGCCGGG + Intronic
964863703 3:161230526-161230548 AGGGAGAAGAATAATTGGCTGGG + Intronic
965131776 3:164709795-164709817 CATAAGCAGCATTATTGGCTTGG + Intergenic
965842324 3:172921026-172921048 AAAAAGTGGAACTAATGGCTAGG - Intronic
966546725 3:181157578-181157600 AAAAATTAGAACTACTGGCTGGG - Intergenic
966586559 3:181632874-181632896 GACAAGTAAATTTATTGGCTGGG - Intergenic
967180611 3:186899909-186899931 AAAAGGTAGAAATAATGGCTGGG - Intergenic
967334999 3:188334722-188334744 TAAAATTAGAAATATTGGCTGGG - Intronic
967374751 3:188788394-188788416 AAGGAGGAGAGTTTTTGGCTAGG - Intronic
967533056 3:190571214-190571236 AAGAAGTATAACTATGGGCCAGG + Intronic
967717461 3:192778628-192778650 TAGAAATAGAATTTTTGACTCGG - Intergenic
968020005 3:195377303-195377325 AAGAAATAGAAAAATTAGCTGGG - Intronic
968154972 3:196373044-196373066 AAAAAGAAGTATAATTGGCTGGG - Intronic
968210556 3:196845119-196845141 CAGAAATAGATTTTTTGGCTGGG - Intergenic
968265235 3:197357633-197357655 AAGAAGTAGAATTATTCAAAAGG - Intergenic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
969815449 4:9683820-9683842 AAGAAATAGAAAAATTAGCTGGG - Intergenic
970104178 4:12561578-12561600 TAGAAGTAGAAGTTTTGGGTAGG - Intergenic
970600038 4:17634617-17634639 AAAAAATAGTATTTTTGGCTGGG - Intronic
970759462 4:19466771-19466793 AGGAAGTAGAATTTTTGTATAGG - Intergenic
970766493 4:19555762-19555784 AAGAAGTACAATAAATGGCCGGG - Intergenic
971084254 4:23252100-23252122 AAGTTGTAGAATTGTTCGCTGGG + Intergenic
971878920 4:32342560-32342582 AAGAACTAGCATTGTTGGCTGGG + Intergenic
972143886 4:35997258-35997280 AAAAAGTACAAATATTAGCTGGG - Intronic
972952778 4:44349251-44349273 AAGAAGGAGAAATATTGGGTTGG + Intronic
973087793 4:46089665-46089687 AAGAAGTAGGAAAATAGGCTAGG + Intronic
974055693 4:56980557-56980579 AAGAAATAGAAAAATTAGCTGGG + Intronic
974095440 4:57358845-57358867 AAGAAGTTGAATAAGTAGCTGGG + Intergenic
974227803 4:59069764-59069786 AAGTAGTAATATTATTGGATAGG + Intergenic
974293494 4:59964287-59964309 AAGAGATGCAATTATTGGCTGGG - Intergenic
974873741 4:67676317-67676339 AAAAAGTAGTACTATAGGCTGGG - Intronic
974887288 4:67835209-67835231 AAGAAGCAGAATTACTTGTTGGG + Intronic
975382508 4:73717689-73717711 AATAAGTAGAATGTTTGGCGTGG + Intergenic
975747238 4:77486567-77486589 AAGAAGTAGAAGAATAGGTTGGG + Intergenic
977215445 4:94277921-94277943 AAGAAGTAGAATTTTATTCTAGG - Intronic
977232447 4:94467771-94467793 AAGAAGTAGAACTGTTGGGTCGG - Intronic
978380468 4:108122779-108122801 AGAAAATAGAATTATTGGCTGGG - Intronic
978853002 4:113360442-113360464 CAGAAGTAGAGCAATTGGCTAGG - Intronic
978987647 4:115034092-115034114 AAGAAGGAGGATTTTTGGCTAGG - Intronic
979013453 4:115400356-115400378 AAGAAGTATAATTATAGGTTAGG - Intergenic
979871061 4:125822568-125822590 AAGAATCAGCATTATTGACTGGG - Intergenic
980197291 4:129606448-129606470 AAGAAATACATTTCTTGGCTGGG - Intergenic
980315982 4:131200649-131200671 TAAAAATAGAATTATTGGCCTGG - Intergenic
980379429 4:131992605-131992627 GAGAAGTTGAATTGGTGGCTGGG - Intergenic
980521920 4:133946920-133946942 AAGGAATAGAATTATAGGTTTGG + Intergenic
980945817 4:139319399-139319421 AAGAAATACAACTTTTGGCTGGG - Intronic
981183658 4:141775784-141775806 AAAAAATACAATTACTGGCTGGG - Intergenic
981950231 4:150397436-150397458 AAAAAGTAAAAATATTAGCTGGG - Intronic
982159731 4:152555533-152555555 AATAAATATAAATATTGGCTAGG - Intergenic
982259603 4:153483121-153483143 AAAAAGTAGAATTAAGGTCTGGG + Intronic
982537375 4:156623642-156623664 AAGAAATAAAATAATTGGCTAGG + Intergenic
984116591 4:175689011-175689033 AAAAAGTAGAATAATTAGCCAGG - Intronic
984297520 4:177872138-177872160 AAGAGGGAGAATTTTTGTCTAGG + Intronic
984780722 4:183523517-183523539 AAAAAGTAGAATCATGGTCTCGG - Intergenic
984974069 4:185214933-185214955 AAGAACTAGAATAATGGGCCTGG + Intronic
985252779 4:188040752-188040774 AAAAAGTAGAAAAATTAGCTGGG + Intergenic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985434069 4:189911780-189911802 TAGAAGTATATTTATTGGCCAGG - Intergenic
985698189 5:1354025-1354047 AAGAAATACAAATATTGCCTGGG - Intergenic
986095744 5:4552457-4552479 AAAAAATAGTATTATAGGCTGGG - Intergenic
986866794 5:11998660-11998682 AAGAAGTAGAAGTATTTACATGG - Intergenic
987207835 5:15645482-15645504 AAGAAGTACATTTGTTGGTTGGG - Intronic
987856949 5:23431876-23431898 AAGATGTATAATTATTTGATGGG - Intergenic
987971031 5:24944934-24944956 AAAAAATTGAATTTTTGGCTGGG + Intergenic
988455626 5:31384683-31384705 AAGAAATAGAATAATTAGCTGGG + Intergenic
988645176 5:33087215-33087237 AAGGACTAGAATTACTGGCATGG - Intergenic
988678614 5:33460606-33460628 AAGAAGCTGTATTATAGGCTAGG + Intronic
988722114 5:33889655-33889677 AAAAACTGAAATTATTGGCTGGG + Intronic
989034464 5:37155533-37155555 AAGAAATAGAATAATTAGCCAGG - Intronic
989213120 5:38877417-38877439 GAGAGGTAGAATTATAGACTAGG - Intronic
989387191 5:40865728-40865750 ATGCAGTATAATTTTTGGCTTGG + Intergenic
990125178 5:52508124-52508146 AAGGATTATGATTATTGGCTGGG + Intergenic
990550040 5:56866249-56866271 CAGAAGTAAAATAATTAGCTGGG + Intronic
990976759 5:61567645-61567667 AAGAAATAGCATTCTAGGCTGGG - Intergenic
990982486 5:61614599-61614621 AAGAAGTGGAAAAAGTGGCTGGG - Intergenic
992146505 5:73855434-73855456 AAAAAGTTGAAGTATCGGCTGGG + Intronic
992252996 5:74894258-74894280 AATAAAAAGAATTATTGGCTGGG - Intergenic
992262208 5:74982612-74982634 AAAAAATACAATTATTAGCTGGG - Intergenic
992594794 5:78335240-78335262 AAAAAGTATGATCATTGGCTGGG + Intergenic
993157348 5:84242500-84242522 TAGAAGTATTATTTTTGGCTAGG + Intronic
993617002 5:90125198-90125220 AAAAAGTATTAATATTGGCTGGG - Intergenic
993777901 5:92024758-92024780 AAGAAGTCAAATTAATGCCTAGG + Intergenic
994187112 5:96827364-96827386 AAGAAATAAAAATATAGGCTGGG + Intronic
994363663 5:98885093-98885115 AAAGAGTAAAATTCTTGGCTGGG + Intronic
994619818 5:102149801-102149823 GAGTACTAGACTTATTGGCTGGG + Intergenic
994728068 5:103459865-103459887 CAGAAGCAGAATAATTGACTTGG + Intergenic
994741777 5:103628261-103628283 AAGAAATGGAATTTTGGGCTGGG + Intergenic
995036146 5:107536809-107536831 AAGAAGTAGATTTTTCGGCCGGG + Intronic
995621329 5:114029308-114029330 AAGAAATAAAAATATTGGCCAGG - Intergenic
995922160 5:117327499-117327521 ATGAATAAGAATTATTGGCTTGG + Intergenic
996076166 5:119197258-119197280 AGGAAGAAGAATAATTGCCTTGG + Intronic
996248305 5:121293606-121293628 AAGAAGTAGAATTATGATCTAGG + Intergenic
996349720 5:122524883-122524905 AAGAATTATAATTATTTACTTGG + Intergenic
996444202 5:123525696-123525718 TAAAAGTAGAAATACTGGCTGGG + Intronic
996505824 5:124266734-124266756 GAGAAGGGGAAATATTGGCTTGG - Intergenic
996620502 5:125496505-125496527 AACAAGTAGAATTCTTGGGTTGG - Intergenic
996621812 5:125514483-125514505 AATATGTATAATTATTGGCCAGG + Intergenic
996833542 5:127766541-127766563 AAGAAGTAGACATCTTGGATGGG - Intergenic
997542937 5:134679351-134679373 AAAAAAAAAAATTATTGGCTGGG - Intronic
997804663 5:136905269-136905291 AAGAATTAAAAAGATTGGCTGGG - Intergenic
998066286 5:139161719-139161741 AAGAATTAGAATTGCTGGCCAGG + Intronic
998250571 5:140549447-140549469 AGGAAGTAGAGTTAAGGGCTTGG - Exonic
998864305 5:146480564-146480586 AAGAAGTAGAGGCATTAGCTTGG + Intronic
998875004 5:146590427-146590449 AAGCAATAGGATTTTTGGCTGGG + Intronic
999041709 5:148420950-148420972 AAAAATTAAAATTCTTGGCTTGG - Intronic
999786463 5:154894916-154894938 AAAAAGTAAAAATATTAGCTGGG + Intronic
1000083671 5:157870257-157870279 AATAAATAGAATAGTTGGCTGGG + Intergenic
1000828903 5:166079568-166079590 AAGAAGTAGTATCATCAGCTGGG - Intergenic
1001977615 5:176013274-176013296 ATGAAGTTGAATTGATGGCTAGG + Intronic
1002239806 5:177830492-177830514 ATGAAGTTGAATTGATGGCTAGG - Intergenic
1003865659 6:10360260-10360282 AAGAAGCTGCATTTTTGGCTGGG + Intergenic
1004002826 6:11611152-11611174 AAGAAGTAAAATAAAAGGCTGGG + Intergenic
1004227936 6:13804477-13804499 AAAAAGTAGAAGTCTTGGCCGGG + Intronic
1004262494 6:14120290-14120312 AAAAAGTATAATTATTGGGCTGG - Intronic
1004898911 6:20176121-20176143 AAAAAGTAAAATAATTAGCTGGG + Intronic
1005064525 6:21805593-21805615 AAAAAGTACAATTTTTGGCCAGG + Intergenic
1005076249 6:21910610-21910632 AAGAATTAGGAGTGTTGGCTGGG + Intergenic
1005181237 6:23109351-23109373 AAGATGTAGAATTTCTGTCTGGG + Intergenic
1005312661 6:24573255-24573277 AAGAAGTCGAATTACTGGGTTGG - Intronic
1005473021 6:26180558-26180580 AAGAACTAGAATGTTGGGCTGGG - Intergenic
1005531870 6:26715797-26715819 AAAAAGTAGATCTATCGGCTGGG + Intergenic
1005538925 6:26785868-26785890 AAAAAGTAGATCTATCGGCTGGG - Intergenic
1005884705 6:30088151-30088173 AAGAAAAAAAAATATTGGCTGGG + Intergenic
1006084100 6:31584012-31584034 CAGGATTATAATTATTGGCTGGG - Intergenic
1008436152 6:51478866-51478888 AAGAAACAAAATGATTGGCTGGG + Intergenic
1009009766 6:57828095-57828117 AAAAAGTAGATCTATTGGCTGGG - Intergenic
1010402384 6:75461376-75461398 TAGAAGAAAATTTATTGGCTTGG + Intronic
1012187213 6:96233732-96233754 ACTAAGTATAATCATTGGCTTGG + Intergenic
1012371016 6:98507378-98507400 TAGAAGTAGCAATATTGGCCAGG - Intergenic
1012449116 6:99336394-99336416 AAAAAGTATTATTTTTGGCTGGG - Intronic
1013492795 6:110665900-110665922 AAAAAATAGAAAAATTGGCTGGG - Intronic
1013505602 6:110797044-110797066 AAGAAATTGGATTTTTGGCTGGG + Intronic
1013743673 6:113319457-113319479 AAAAAGAAGTATTATTGGCCAGG + Intergenic
1013777244 6:113692081-113692103 AAGTACTAGAATTACAGGCTGGG + Intergenic
1014538070 6:122640353-122640375 ATGAAGTAGAACAATTGTCTTGG - Intronic
1014867155 6:126546830-126546852 ATGAAGTAAAATTATTTGGTGGG + Intergenic
1015468220 6:133572496-133572518 AAGAAATACAATTCTGGGCTGGG + Intergenic
1015574053 6:134652049-134652071 AACTAGTAGAATAATTGGATGGG + Intergenic
1015855949 6:137624828-137624850 AATAAGTAAATTTTTTGGCTGGG + Intergenic
1016335960 6:143005482-143005504 AGGAGGTAGAATTTTTGTCTGGG + Intergenic
1016513798 6:144871730-144871752 AAAAAGTACAAAAATTGGCTGGG + Intergenic
1017178975 6:151532309-151532331 AAGAATAAGACTTCTTGGCTGGG + Intronic
1017300988 6:152857474-152857496 TAGAAGTAGAATTGCTGGGTCGG - Intergenic
1017467957 6:154712481-154712503 AAAAAGTAAAAATATTTGCTGGG - Intergenic
1017472852 6:154757288-154757310 AAAAAGTATATTTATTGGCTGGG - Intronic
1018066448 6:160127884-160127906 AAGATGTGGAATTATTACCTGGG - Intronic
1018156087 6:160986552-160986574 AAGAAGTACAAAAATTAGCTGGG - Intergenic
1018268210 6:162048657-162048679 AGGAAGAAGAATAATTGTCTTGG + Intronic
1019362889 7:614603-614625 AAAAAGTAAAAAAATTGGCTGGG + Intronic
1019751362 7:2732384-2732406 AAGAAGTAAAAACATTAGCTGGG + Intronic
1019979403 7:4610148-4610170 AAGAAGAAGAAGAATTAGCTGGG + Intergenic
1019989409 7:4681672-4681694 AAGAAGTAAAAAAATTAGCTGGG + Intergenic
1020201052 7:6080435-6080457 AAAAAAAAGAATTACTGGCTGGG + Intergenic
1021074661 7:16287614-16287636 AGGAAAAAGAAATATTGGCTGGG + Intronic
1021837131 7:24689107-24689129 AAAAAGTACACTTCTTGGCTAGG - Exonic
1022016954 7:26358441-26358463 GAGAAGAAGAAATACTGGCTGGG + Intronic
1023113243 7:36835303-36835325 CAGAGGCAGAATTATTGACTAGG + Intergenic
1023458881 7:40371902-40371924 AAAAAGTATAATTATTGCTTTGG + Intronic
1023462532 7:40414745-40414767 AAAAAGTATAAAAATTGGCTGGG + Intronic
1023482988 7:40655002-40655024 AACAAATATAATTATAGGCTAGG + Intronic
1024003423 7:45206980-45207002 TAGAATTATAATTATTCGCTAGG - Intergenic
1024130489 7:46347507-46347529 AAGAAGTAGAGTTGCTGACTCGG - Intergenic
1024299222 7:47873849-47873871 AAGAAATACAAATAATGGCTAGG + Intronic
1025013214 7:55416033-55416055 TAGGAGTAGAATTACTGGATCGG + Intronic
1025253362 7:57366600-57366622 AAAAAGTAGAAAAATTAGCTGGG + Intergenic
1025744747 7:64232943-64232965 AAGAAATAGAGTCATAGGCTGGG + Intronic
1025796354 7:64741179-64741201 TAGAAGTAAAAATATTGGCCAGG - Intergenic
1025851332 7:65247136-65247158 AAGAAGTAGAATTACTACATGGG + Intergenic
1025972900 7:66344704-66344726 AAAAATTAGAAATGTTGGCTGGG - Intronic
1025996950 7:66533796-66533818 TAAAAGTAAAATTATAGGCTGGG - Intergenic
1026989848 7:74578469-74578491 TAAAAGTAAAATTATAGGCTGGG - Intronic
1027473678 7:78603814-78603836 AGAAAATAGAAATATTGGCTGGG - Intronic
1027532149 7:79349374-79349396 AAGAAGTAGAATACTTGTCCAGG - Intronic
1029098056 7:98105019-98105041 TAGAAGTAGAAGTATAGGCTAGG + Intergenic
1029349685 7:100004265-100004287 AAGAAGAAACAGTATTGGCTGGG - Intergenic
1030140726 7:106301820-106301842 AAGAACTTGCATTACTGGCTGGG + Intergenic
1030290432 7:107866960-107866982 AAGAATTATATTTATGGGCTAGG + Intergenic
1030918828 7:115353503-115353525 AAGGAGTAAAATTCTGGGCTGGG + Intergenic
1031187422 7:118500804-118500826 AAGAAGTAGAATAAGTTGGTGGG - Intergenic
1031383979 7:121123326-121123348 AAGAAGGACAAATATTGGCCTGG - Intronic
1031600403 7:123700731-123700753 AAGAGGTAGAATAGTTGGCCGGG - Intronic
1031848536 7:126834803-126834825 AAGAAACAGCATTATAGGCTGGG + Intronic
1032170075 7:129577399-129577421 AAAAAATAGAATTATAGGCCAGG - Intergenic
1032208517 7:129890837-129890859 AAGAAGTCAACTTATAGGCTGGG + Intronic
1032432467 7:131873030-131873052 AAAAACTGGAATTATGGGCTGGG + Intergenic
1032563438 7:132915812-132915834 AAGAAGTTCAAGGATTGGCTAGG - Intronic
1032820110 7:135516592-135516614 TAGAAGAAGAATAATTGTCTTGG - Intergenic
1033236098 7:139638949-139638971 AAAAATGACAATTATTGGCTGGG - Intronic
1033344453 7:140516584-140516606 AAGATGTACATTTATTTGCTTGG + Intergenic
1033892584 7:146033395-146033417 AAAAAATAGAATTTTTGGCCGGG + Intergenic
1034226004 7:149482758-149482780 AAAAATTAGAGTTATTGGCTGGG - Intronic
1034458071 7:151182280-151182302 AAGAACAAGACTGATTGGCTGGG + Intronic
1034757471 7:153635912-153635934 ACAAAGTAGAATAGTTGGCTGGG - Intergenic
1034785455 7:153922203-153922225 AATAAAAAGAATAATTGGCTGGG + Intronic
1035413660 7:158666629-158666651 TAGAAGTAGACTTATTGGCTGGG + Intronic
1037871210 8:22498827-22498849 TAAAAGTAGAATTATTGGCCGGG + Intronic
1038286804 8:26212582-26212604 AAGAAGTAGATTGATTGGCAAGG - Intergenic
1039355552 8:36811634-36811656 AAGAAGTAGTGGTAGTGGCTGGG + Intronic
1040460119 8:47639650-47639672 CAGAAGGAGATTTATTGGCCAGG + Intronic
1040586028 8:48742160-48742182 AAGAAGTGAAAGTTTTGGCTGGG + Intergenic
1040674111 8:49728029-49728051 AAGATGTAGAAATGTTGCCTAGG + Intergenic
1041628030 8:60053687-60053709 AATAAGTAGAAATATTATCTTGG - Intergenic
1041633170 8:60111048-60111070 AAGAAGCATAATTATAGGCCGGG - Intergenic
1041854750 8:62438720-62438742 AAAAAGTACAAAAATTGGCTGGG - Intronic
1042414008 8:68498646-68498668 AAGAACTAGAATTTTTGGCATGG + Intronic
1042468883 8:69160734-69160756 AAAAAGTACAAATATTAGCTGGG - Intergenic
1042955933 8:74250674-74250696 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1043062574 8:75523341-75523363 AAGAAGTTGAATTAGTATCTGGG - Intronic
1043249933 8:78059098-78059120 AAGAAGTAGAATTCATTGCAAGG + Intergenic
1043329091 8:79091393-79091415 TTGAAGTAGAATTTTTGGTTTGG - Intergenic
1043389474 8:79778160-79778182 AAAATGTAAAAATATTGGCTGGG - Intergenic
1043438656 8:80257839-80257861 AAGAAGTACAAAAATTAGCTGGG - Intergenic
1043705091 8:83339196-83339218 TAAAACTACAATTATTGGCTGGG + Intergenic
1043793346 8:84503026-84503048 AATAAGAAGAAATATTGGCACGG + Intronic
1043860815 8:85314694-85314716 AAGAATATGAATTATTGGCTGGG - Intergenic
1044129845 8:88508409-88508431 AATAAATAAAATTATTGGCCAGG + Intergenic
1044973176 8:97639459-97639481 AAGAAGTAGAAAAATTAGCTGGG - Intergenic
1045084721 8:98670206-98670228 AAAAAATAGAAATATTAGCTAGG + Intronic
1045092949 8:98765974-98765996 AAGATTTAGAATTATTGGAATGG - Intronic
1045203614 8:100013334-100013356 AAGAAGTTGAAATGGTGGCTAGG + Intronic
1045476019 8:102553389-102553411 AAAAAGGATAATTATTGTCTAGG + Intronic
1045877902 8:107003861-107003883 AAGAATTGGAAGTTTTGGCTGGG + Intergenic
1046093696 8:109533472-109533494 AATTATTAGAATTATTGGCTGGG + Intergenic
1046397105 8:113655354-113655376 AAAAATTATAATTGTTGGCTGGG + Intergenic
1046742295 8:117842477-117842499 GAGAAGTTGAATGATTTGCTGGG - Intronic
1046937904 8:119903391-119903413 AAAAAATAGTATTTTTGGCTGGG - Intronic
1047000097 8:120564864-120564886 AAAAAATAGAATCATAGGCTGGG - Intronic
1048979419 8:139695085-139695107 ACAAAGTAGAATTATGTGCTAGG - Intronic
1051361292 9:16283796-16283818 AAGAACTACAATTATTAACTTGG - Intergenic
1052013091 9:23434110-23434132 AAGTAACTGAATTATTGGCTGGG + Intergenic
1052291532 9:26846980-26847002 AAGAAGAAGAAAAATTGGCCGGG - Intronic
1052563795 9:30120137-30120159 AAAAAGTAGAATCACTTGCTTGG + Intergenic
1053224926 9:36346484-36346506 AATAAGCATAATAATTGGCTGGG - Intronic
1053482839 9:38428708-38428730 AAGAAGAGGAATTATTAACTAGG - Intergenic
1053482877 9:38429021-38429043 AAAAAAAAGAATTATTGGCTGGG - Intergenic
1053524525 9:38815315-38815337 AAAAAGAGTAATTATTGGCTGGG - Intergenic
1054196760 9:62039715-62039737 AAAAAGAGTAATTATTGGCTGGG - Intergenic
1054641644 9:67548977-67548999 AAAAAGAGTAATTATTGGCTGGG + Intergenic
1054742952 9:68827045-68827067 AAAAAGTGGAATTTTTGGCCGGG - Intronic
1054957345 9:70927964-70927986 AAGCAGTATATTTATTGTCTTGG - Intronic
1055444391 9:76368256-76368278 AAGAAGTTGTATTAGTGGCCAGG - Intergenic
1055664127 9:78536162-78536184 TAGAAGAAGAATAATTGTCTTGG + Intergenic
1055946166 9:81693101-81693123 AAAAACTATAATTATTGGCCAGG - Intergenic
1056375924 9:86010945-86010967 TAAAATTAAAATTATTGGCTGGG + Intronic
1056889197 9:90474068-90474090 AAGAAGAAGAAGAATTGTCTTGG + Intergenic
1057166918 9:92935503-92935525 AATAAGTATAATTAGTGACTTGG - Intergenic
1057933770 9:99219811-99219833 TAGAGGAAAAATTATTGGCTTGG - Intronic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058758111 9:108102577-108102599 AATAAGGAGAATTATTTGCATGG + Intergenic
1059063222 9:111055112-111055134 AAAAAGTAGTATTAAGGGCTGGG - Intergenic
1059079175 9:111229948-111229970 AAGAAGTAAAAATATTAGCCAGG + Intergenic
1059159049 9:112016400-112016422 AAAAAGAAGAATTTGTGGCTGGG - Intergenic
1060708053 9:125825121-125825143 AAGAAATACAATAATTGGCTGGG + Intronic
1061718470 9:132536687-132536709 TAAAAGTAGAACTATGGGCTGGG - Intronic
1061827080 9:133265214-133265236 AAAAAGTAGAATAATTAGCCGGG - Intronic
1185932168 X:4215312-4215334 AAAAAATAGAAATGTTGGCTGGG - Intergenic
1186214286 X:7282359-7282381 AAAAAATAAAATTATTAGCTGGG - Intronic
1187131632 X:16508954-16508976 AAGAAATACAAAAATTGGCTGGG + Intergenic
1187204825 X:17171819-17171841 AAGAATTATAATTATGGGCCAGG - Intergenic
1187285725 X:17901704-17901726 AAAAAGTATAACTATTAGCTGGG + Intergenic
1187344606 X:18451484-18451506 AAGAAGTAGAGATATTGGCTGGG - Intronic
1187624567 X:21096110-21096132 TAGGTATAGAATTATTGGCTGGG + Intergenic
1188338556 X:28970295-28970317 AAGATGTAAAAGTTTTGGCTGGG - Intronic
1188468154 X:30506270-30506292 GAGAAGATGAATAATTGGCTTGG - Intergenic
1188533554 X:31169035-31169057 AGAAAGTAGGGTTATTGGCTTGG - Intronic
1188965043 X:36541042-36541064 AAGAGTTAGCAATATTGGCTGGG + Intergenic
1189064579 X:37793714-37793736 AAGGATCAGAATTATTGACTCGG - Exonic
1189333621 X:40157058-40157080 TAGAAGTCGAATGGTTGGCTTGG + Intronic
1189802487 X:44704761-44704783 AAGAAGAAGAAAAATTAGCTGGG + Intergenic
1189813866 X:44805389-44805411 AAAAAGTAAAAATATTAGCTGGG - Intergenic
1190019603 X:46862076-46862098 AAGAAGTAGGATATTTGGCTGGG + Intronic
1190341768 X:49302670-49302692 AAGAAGAAGAAAAATTAGCTGGG - Intergenic
1191149397 X:57204651-57204673 AAGAAGCAGAACTACTGGTTTGG - Intergenic
1192419570 X:71017189-71017211 TAGAAGTTTAATTATAGGCTGGG - Intergenic
1192487146 X:71537596-71537618 ATTAAATAAAATTATTGGCTGGG - Intronic
1193100317 X:77603669-77603691 AAGAATTAATATTATTGGCCAGG - Intronic
1193420254 X:81274315-81274337 AAGAAAGACAATAATTGGCTGGG + Intronic
1194172475 X:90604112-90604134 AAAAAGTACACTTATAGGCTGGG - Intergenic
1194661995 X:96638257-96638279 AAGAAAGAGGTTTATTGGCTGGG - Intergenic
1194665589 X:96674111-96674133 GAGATGAAGAATTATTAGCTTGG - Intergenic
1195054433 X:101129524-101129546 AAGAAGAAGAAGAATTGGCCTGG - Intronic
1195375824 X:104227070-104227092 TAGAAGTAGAACTACTGGATAGG - Intergenic
1196032548 X:111106863-111106885 AAGGAGTAGAATTTATGTCTAGG + Intronic
1196333050 X:114494599-114494621 AAGAAGTATAAAAATTAGCTGGG + Intergenic
1197352869 X:125399625-125399647 AAGAAGTAAAATGAGTGCCTTGG + Intergenic
1198036515 X:132806229-132806251 AAGTAGTAGCAATATTGGTTAGG - Intronic
1198533165 X:137564451-137564473 AAGAAGGTGAAGTGTTGGCTGGG + Intergenic
1198892581 X:141414734-141414756 AAGAATTGTAATTATCGGCTCGG - Intergenic
1200296220 X:154923539-154923561 AAAAAGAAGAGTTTTTGGCTGGG + Intronic
1200518702 Y:4181851-4181873 AAAAAGTACACTTATAGGCTGGG - Intergenic
1201317364 Y:12661044-12661066 AAGAAGTACAAGTGTTGGCCAGG - Intergenic
1201713067 Y:17013472-17013494 AAAAAATAGAAATGTTGGCTGGG - Intergenic