ID: 1153624487

View in Genome Browser
Species Human (GRCh38)
Location 18:7011260-7011282
Sequence AGGAAGCACCGACTGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153624481_1153624487 20 Left 1153624481 18:7011217-7011239 CCGGCCCAGACTATGGTGATTTT 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1153624487 18:7011260-7011282 AGGAAGCACCGACTGGCTCTCGG 0: 1
1: 0
2: 0
3: 13
4: 113
1153624483_1153624487 15 Left 1153624483 18:7011222-7011244 CCAGACTATGGTGATTTTAAACA 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1153624487 18:7011260-7011282 AGGAAGCACCGACTGGCTCTCGG 0: 1
1: 0
2: 0
3: 13
4: 113
1153624482_1153624487 16 Left 1153624482 18:7011221-7011243 CCCAGACTATGGTGATTTTAAAC 0: 1
1: 0
2: 1
3: 14
4: 190
Right 1153624487 18:7011260-7011282 AGGAAGCACCGACTGGCTCTCGG 0: 1
1: 0
2: 0
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153624487 Original CRISPR AGGAAGCACCGACTGGCTCT CGG Intronic
900429746 1:2595965-2595987 GGGCAGCCCCGACTGGATCTGGG - Intronic
900576678 1:3386011-3386033 ATGAAGCAGCGACCAGCTCTGGG - Intronic
902447784 1:16478159-16478181 AGGGAGCACCCACTGGGTCCTGG - Intergenic
903349334 1:22708931-22708953 AGGAAGTAACCACTGGCCCTGGG + Intergenic
907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG + Intronic
907872695 1:58457303-58457325 AGGGAGCACTGTCTGACTCTCGG - Intronic
908127648 1:61047141-61047163 AGAACGCACCAACTGGCTCTAGG - Intronic
909259792 1:73472801-73472823 AGGAAGAACTGCCTGACTCTGGG + Intergenic
916755588 1:167767074-167767096 AGGGAGCAAACACTGGCTCTTGG - Intronic
917629248 1:176876806-176876828 AGGAAGCAGTGAGAGGCTCTAGG - Intronic
918268797 1:182874607-182874629 AGGATACCCCAACTGGCTCTGGG + Intronic
919425859 1:197429582-197429604 TTGAAGCACCGGCTGGCACTGGG - Exonic
919997530 1:202766974-202766996 AGGCTGCACAGACTGCCTCTGGG + Exonic
923394734 1:233550448-233550470 AGAGAGCAGAGACTGGCTCTAGG - Intergenic
1067322986 10:45239912-45239934 ATGTAGCTCCGTCTGGCTCTCGG - Intergenic
1069892992 10:71663454-71663476 AGGAAGCCCTGACTGACTCATGG + Intronic
1070675919 10:78411125-78411147 ATGAAGCACCCACTTGCTGTTGG - Intergenic
1072612608 10:97028657-97028679 AGGAAGCAGTGACTAACTCTGGG - Intronic
1072640277 10:97206408-97206430 AGAGAGCACCCACAGGCTCTGGG + Intronic
1072817879 10:98527477-98527499 AGGAAGCACCGTCTTGCGCAGGG - Intronic
1075405772 10:122194943-122194965 AGCCAGAACCCACTGGCTCTGGG + Intronic
1075411535 10:122232024-122232046 TGTAAGCACCCACTGTCTCTGGG - Intronic
1075662766 10:124209631-124209653 GGGAAGCACCGACCTGCTCTGGG + Intergenic
1076671448 10:132122919-132122941 AGGAATCACCCACTGGCCCAGGG + Intronic
1083156374 11:60825819-60825841 AGGAACCACTGACTTGCCCTAGG - Intergenic
1083919695 11:65775648-65775670 AGGAAGCTCCCACTGGAGCTGGG - Intergenic
1084474237 11:69379744-69379766 ATCAAGCACCTACTGGCTCTTGG - Intergenic
1084935225 11:72583368-72583390 AGGAAGCCCTGCCTGGCCCTGGG + Intronic
1085337471 11:75707062-75707084 AGGAAGCACAGACCCTCTCTGGG - Intergenic
1088992112 11:114962662-114962684 AGGAAACCCTCACTGGCTCTAGG - Intergenic
1090254226 11:125272033-125272055 AAAAGGCACCGAGTGGCTCTGGG - Intronic
1092238188 12:6822475-6822497 AGGAAGCACATAATGGCTTTAGG - Intronic
1099317347 12:81100826-81100848 AGTAAGTACCCACTGGCTTTTGG + Intronic
1102779029 12:115547432-115547454 AGGAAGGACAGTTTGGCTCTAGG + Intergenic
1104611915 12:130235665-130235687 ATAAAGCACCGACTGCCCCTAGG - Intergenic
1109999288 13:70173824-70173846 GGGAAGCAGCTACTGCCTCTAGG - Intergenic
1112107664 13:96259410-96259432 TGGAAGCACAAAGTGGCTCTGGG + Intronic
1114069555 14:19096738-19096760 AGGCAGCTCTGAGTGGCTCTTGG - Intergenic
1114092707 14:19303265-19303287 AGGCAGCTCTGAGTGGCTCTTGG + Intergenic
1114843066 14:26289034-26289056 AGGAAGCACCTACTACCCCTAGG + Intergenic
1115455274 14:33594698-33594720 CAGAAGGACCGACTGCCTCTTGG + Intronic
1117043206 14:51786745-51786767 AGGAAGCAGCTACTGCCCCTAGG - Intergenic
1123826601 15:24088268-24088290 GGGAATCACCGACTTGCTCATGG + Intergenic
1124115696 15:26841775-26841797 TGGAAGCATCGCCTGGCCCTAGG + Intronic
1127783454 15:62335739-62335761 AGGAAGCAGCTACTGCCTGTAGG - Intergenic
1128113597 15:65091970-65091992 AGAAAGCACCGAGGGGCTATTGG + Intergenic
1131711979 15:95065731-95065753 AGGAATCACTTACAGGCTCTTGG + Intergenic
1136060682 16:27724241-27724263 AGGAAGCACTGAGTGGGACTTGG - Intronic
1136386549 16:29930133-29930155 AGGACACACTTACTGGCTCTTGG - Intergenic
1141280095 16:82623557-82623579 AGGAGGCAGCTACTGGCTGTTGG + Intergenic
1141685850 16:85569558-85569580 AGGAAGGGCGGACTTGCTCTTGG + Intergenic
1141727584 16:85799856-85799878 AGGAAGCACCGAATGGGCCTCGG + Exonic
1143949908 17:10624201-10624223 AGGAAGCTCTGGCTGGCCCTGGG + Intergenic
1144628369 17:16857075-16857097 AGGAGGAACCAGCTGGCTCTGGG + Intergenic
1144789021 17:17847335-17847357 AGGAAGCACTGCCTGGGGCTGGG + Exonic
1145159961 17:20567645-20567667 AGGAGGAACCAGCTGGCTCTGGG + Intergenic
1147506347 17:41021302-41021324 AGGAAGCAGCTACTGACCCTAGG - Intergenic
1147506648 17:41024664-41024686 AGGAAGCAGCTACTGACCCTAGG + Intergenic
1153623867 18:7005010-7005032 GGGAAGCTCCCACTGACTCTGGG + Intronic
1153624487 18:7011260-7011282 AGGAAGCACCGACTGGCTCTCGG + Intronic
1158670838 18:59472265-59472287 AGGAAGCAGCTACCGCCTCTAGG - Intronic
1161626912 19:5332494-5332516 AGGAAGCCCTGAATGGCTCCAGG - Intronic
1164431607 19:28193812-28193834 AGGAAGCACCGAGGGGATCCAGG + Intergenic
1167574148 19:50309723-50309745 AGGAAGCACAGCCTGGGTCTGGG + Exonic
1168348189 19:55660925-55660947 AGAAAGCTCCTACAGGCTCTCGG - Intronic
925600735 2:5606510-5606532 AGGAGGCAGCGATTGTCTCTCGG - Intergenic
926114508 2:10203954-10203976 AGGAAGCACCAGCAGTCTCTGGG - Intronic
931635273 2:64335072-64335094 AGTAAGCAGTGACTGTCTCTGGG - Intergenic
935965608 2:108471675-108471697 AGGATTCACCGACTGCCTGTAGG - Exonic
935983853 2:108653376-108653398 AGGAAGCACTCACTGACTCTTGG + Intronic
936136286 2:109897030-109897052 AGGAAGCACTCACTGACTCTTGG + Intergenic
936208411 2:110474455-110474477 AGGAAGCACTCACTGACTCTTGG - Intergenic
946221283 2:218229727-218229749 GGGAAGCAACCAATGGCTCTTGG - Intronic
946275651 2:218629708-218629730 AGGGAAGAACGACTGGCTCTGGG + Intronic
1172605424 20:36210399-36210421 AGGAGGGACAGACTGTCTCTGGG + Intronic
1174406250 20:50305211-50305233 AGGAAAAAGAGACTGGCTCTGGG - Intergenic
1178536059 21:33411333-33411355 AGGAAGCACCAAGGGGCTCCGGG - Intronic
1180488022 22:15819301-15819323 AGGCAGCTCTGAGTGGCTCTTGG - Intergenic
1181060561 22:20280290-20280312 AGGCAGCACCCACTGGGGCTCGG + Intronic
1182316275 22:29449430-29449452 AGGCAGCACAGGCTGGCTCCAGG + Intergenic
1183310099 22:37104998-37105020 AGGAAGCCCCGCCTGCATCTGGG - Intronic
1183605843 22:38866397-38866419 AGGAGGCACCGGCGGGCTCAGGG + Exonic
1185370417 22:50458410-50458432 AGGCAGCAGCCACTGGCACTGGG + Intronic
952567096 3:34672121-34672143 AAGAAGCACCCAGTGGCTCATGG + Intergenic
953503381 3:43459639-43459661 AGGAAGCACTCACTAGCTCTGGG - Intronic
954805460 3:53217407-53217429 AGGAAGCTGGGACTGGCCCTCGG + Intergenic
954960694 3:54562228-54562250 TGAAAGCACAGACTGCCTCTTGG - Intronic
956799291 3:72742282-72742304 AGGAAGCACCTAGAGGATCTAGG + Intergenic
957173139 3:76765671-76765693 AGGCAGCACATACTGGCTCTTGG - Intronic
961923495 3:130451560-130451582 TGGAATCACCTAGTGGCTCTGGG - Intronic
965714318 3:171586428-171586450 AGGAAGCAGCTACTGCCCCTGGG - Intergenic
968520534 4:1032907-1032929 AGGATGCTCCGTCTGCCTCTGGG + Intergenic
969180294 4:5435437-5435459 AGGAAGGAGCGAGTTGCTCTGGG - Intronic
969268788 4:6084813-6084835 ATGAGGCACCGCCTGTCTCTTGG + Intronic
974448489 4:62018186-62018208 AGGAAGCACCTGCTGGCCTTTGG - Intronic
974814928 4:66991698-66991720 AGGAACCTATGACTGGCTCTAGG + Intergenic
975697144 4:77024496-77024518 AGGAAGCAGGGAGTGGCTCATGG - Intronic
985763327 5:1763071-1763093 AGGAAGCACCTGCTGGGTTTGGG + Intergenic
989318047 5:40104722-40104744 CGGAATCACCTAGTGGCTCTGGG + Intergenic
995152981 5:108873085-108873107 AGGAAATGCAGACTGGCTCTTGG + Intronic
995383494 5:111563149-111563171 AGGAAGAACTAGCTGGCTCTAGG - Intergenic
999044586 5:148453335-148453357 AGGGAGCAACTACTAGCTCTAGG - Intronic
999318307 5:150598350-150598372 CGGCAGCACAGACTGGCTCTAGG - Intergenic
1002500941 5:179647281-179647303 AGAAAGCACCGCAGGGCTCTGGG + Intergenic
1003194553 6:3903176-3903198 AGGAAGCAGCTGATGGCTCTGGG + Intergenic
1003224545 6:4191803-4191825 TGGCAGCACTCACTGGCTCTCGG - Intergenic
1006040727 6:31252390-31252412 AGGAAGCAGCAAATGGGTCTTGG + Intergenic
1006051060 6:31344780-31344802 AGGAAGCAGCAAATGGGTCTTGG + Intronic
1007654350 6:43443253-43443275 AGGCAGCAATGACTGGCTCAGGG - Intronic
1011165742 6:84443964-84443986 AGGAGGCACCTGCTGGCTGTGGG + Intergenic
1017198743 6:151730019-151730041 AGGAAGCAATGACTAGCTTTAGG - Intronic
1017789182 6:157780874-157780896 AGGAAGCACAAACTTGTTCTTGG + Intronic
1021910375 7:25379865-25379887 AGAAAGCATGGACTGGCCCTAGG - Intergenic
1022256108 7:28659968-28659990 GGGAAGCACCCACTTGCTCCTGG - Intronic
1022519865 7:30999210-30999232 AGGAAGCACAGACTGGTAGTGGG - Intergenic
1024158783 7:46653059-46653081 TGGAATCATCAACTGGCTCTAGG - Intergenic
1031576957 7:123426500-123426522 TGGAAGCCTGGACTGGCTCTTGG + Intergenic
1032080453 7:128856072-128856094 AAGAAGCACAGAAGGGCTCTGGG - Intronic
1032101820 7:128986064-128986086 GGGAAGCATATACTGGCTCTAGG - Intronic
1048161576 8:132026502-132026524 AGGAAGGACAGAGTGGCTCTGGG - Intronic
1056791037 9:89625508-89625530 AGGCCTCACCGTCTGGCTCTTGG + Intergenic
1061684331 9:132262566-132262588 AGGAAGCAGTGGCTGACTCTGGG + Exonic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1188512344 X:30949828-30949850 AGGAAGCAGCCACTATCTCTAGG - Intronic
1192223795 X:69215010-69215032 AGGAAGCAATGGCTTGCTCTCGG + Intergenic
1194359237 X:92928163-92928185 AGACAGCACCAACTGGCACTAGG - Intergenic
1200667449 Y:6044197-6044219 AGACAGCACCAACTGGCACTAGG - Intergenic