ID: 1153626353

View in Genome Browser
Species Human (GRCh38)
Location 18:7025295-7025317
Sequence CGTTCTAGGCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153626353 Original CRISPR CGTTCTAGGCAGATGGAGCT GGG (reversed) Intronic
901094286 1:6665865-6665887 CGGTATTGGCAGATGGAGGTGGG - Intronic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902742509 1:18448729-18448751 TGTCCAAGGCAGATGGAGATAGG - Intergenic
904918985 1:33991700-33991722 AGCTCTAGGCAGAGGGACCTTGG + Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
906193034 1:43910931-43910953 CTCTCAAGGCAGATGGACCTGGG - Intronic
906818756 1:48906640-48906662 CATTGTATGCAGATGGAGCGAGG + Intronic
915846901 1:159276259-159276281 TCTTCAAGGAAGATGGAGCTGGG + Intergenic
916443064 1:164846576-164846598 CCTTCTAGGCTAATGGAGGTTGG + Exonic
917074894 1:171194122-171194144 CTTTCAAGGCAAATGAAGCTAGG - Intronic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
919346975 1:196394460-196394482 AGTTCTATACAGATGGTGCTGGG + Intronic
922253428 1:223871019-223871041 CGATCTAGGACGATTGAGCTTGG - Intergenic
1065938012 10:30538468-30538490 CGTTCACAGCAGATAGAGCTGGG - Intergenic
1067437898 10:46291833-46291855 AGTCCCAGGCAGATGGGGCTGGG + Intronic
1067662507 10:48246968-48246990 CGCTCTAGGCATATGAAGCATGG - Intronic
1068668572 10:59701354-59701376 CGGTTTAGGAAGATGGATCTGGG - Intronic
1068892630 10:62163606-62163628 CCTTCTAGGCAGATGATGCCTGG + Intergenic
1071208350 10:83310273-83310295 CATTCTAGGCAGAGAGAGCTGGG - Intergenic
1071851821 10:89580555-89580577 CTTTCCAAGCAGAGGGAGCTGGG - Exonic
1072048952 10:91684463-91684485 TGTTCTAGAAAGATAGAGCTAGG + Intergenic
1078324582 11:10369348-10369370 GGTTCTTGGTAGATAGAGCTGGG - Intronic
1078923396 11:15852190-15852212 CGTTAGAGTCAGATGGATCTGGG - Intergenic
1084965613 11:72742941-72742963 CATTCCAGCCAGAAGGAGCTCGG - Intronic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1088714724 11:112538878-112538900 TGTTCTAAGTAGCTGGAGCTGGG - Intergenic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1094143779 12:27207736-27207758 CATTCCAGGCAGAAGGAGGTAGG - Intergenic
1101332661 12:103769528-103769550 GGCCCTAGGCAAATGGAGCTTGG + Intergenic
1103561644 12:121796007-121796029 CGCTCCAGGCAGGTGGGGCTGGG - Intronic
1103679608 12:122682840-122682862 TGTTTTAGAAAGATGGAGCTGGG + Intergenic
1107082952 13:36394489-36394511 CGTTAAGGGCTGATGGAGCTGGG + Intergenic
1112247294 13:97746746-97746768 CGATCTTGGCAGATGGACCCAGG - Intergenic
1114620127 14:24090827-24090849 AGCTTTAGGCAGATGGAGCAAGG - Intronic
1126872295 15:53002567-53002589 CATTCTAGACAGAGGGAGCTGGG - Intergenic
1134277932 16:12793027-12793049 CCCTGTAGGCAGATGCAGCTTGG + Intronic
1134668589 16:16037903-16037925 CGTGGGAGGCAGATAGAGCTTGG + Intronic
1138597897 16:58038875-58038897 CTTCCTTGGGAGATGGAGCTTGG - Intronic
1147325144 17:39666439-39666461 CGCTCTAGGCAGAAGAAGCTGGG + Exonic
1153626353 18:7025295-7025317 CGTTCTAGGCAGATGGAGCTGGG - Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1161495486 19:4583937-4583959 CGTTCTAGGCAGAGAGACCTCGG + Intergenic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1164648615 19:29876225-29876247 CCTTCTGGGCAGGTGGACCTGGG - Intergenic
1165487976 19:36106921-36106943 CGAACTAGGCAGATGGGCCTAGG - Intergenic
925030257 2:645039-645061 CGGTCTGGACAGATGGAGCCTGG + Intergenic
925645896 2:6036726-6036748 GTTTCTAGGAAGATGGTGCTAGG + Intergenic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
930021526 2:47004700-47004722 TGTTCTGGGCAGATGCTGCTGGG - Intronic
930118920 2:47743950-47743972 ATGTCTAGGCAGATGGAGGTGGG + Intronic
930354695 2:50303041-50303063 TGTTCTAGGCAGACTGAGTTCGG - Intronic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
932912726 2:75821738-75821760 CATTCTTGCCAGATGGGGCTTGG + Intergenic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
938716613 2:134027675-134027697 AGTTCTGGGGAGAGGGAGCTGGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
940333126 2:152497050-152497072 CGTTCTCAACAGATAGAGCTAGG + Intronic
1169001640 20:2172228-2172250 GGTTCCAGGCAGAGGGAGCAGGG - Intronic
1170422960 20:16210696-16210718 TGTTCTAGGCAGAAAGAGCAGGG - Intergenic
1171352931 20:24518619-24518641 CGCTCTGGGCAGAAGGTGCTGGG + Intronic
1172514125 20:35521423-35521445 CATTCCAGGCAGAGGGAGCAAGG + Intergenic
1175769297 20:61613286-61613308 CCTTCCAGGCAGAGTGAGCTGGG + Intronic
1178736271 21:35155070-35155092 GGTTCCAGGCTGATGGAGCTCGG + Intronic
1179110253 21:38439957-38439979 TATTCTAGGCAGAAGGAGGTGGG + Intronic
1182881499 22:33737803-33737825 GATTCTAGGGAGATGGGGCTGGG + Intronic
1184550326 22:45200977-45200999 CGTTCCAGCCAGAGGGAACTTGG + Intronic
950167808 3:10814907-10814929 CTTTCTGGGGAGATGGAGGTTGG + Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
950945841 3:16945099-16945121 TGTTCCAGGCAGAGGGAACTGGG - Intronic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
953201426 3:40781439-40781461 TGTTTTAGGCAAATGCAGCTAGG - Intergenic
953980871 3:47412426-47412448 GGATCTGGGCAGATGGGGCTGGG + Intronic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
958617498 3:96514615-96514637 TGTACTAGGCAGTTGCAGCTGGG - Intergenic
964767359 3:160191664-160191686 AGTTCTAGGGATCTGGAGCTGGG - Intergenic
968376462 4:46796-46818 ACTTGTAGGCAGATGCAGCTGGG - Intergenic
980566744 4:134552303-134552325 CATTCTAGGTAGTTAGAGCTTGG + Intergenic
985676246 5:1232688-1232710 GCTTCTGGGCAGAGGGAGCTGGG + Intronic
986101337 5:4614396-4614418 AGACCTTGGCAGATGGAGCTGGG - Intergenic
986232566 5:5880027-5880049 CGTTGTATGCACATGAAGCTGGG + Intergenic
989266970 5:39486304-39486326 CTTTGAAGGCAGAGGGAGCTAGG - Intergenic
997263249 5:132479585-132479607 AGTTCTAGGTTGAGGGAGCTAGG - Intergenic
998651300 5:144124395-144124417 AGTTCCAGGAAGATGGACCTAGG - Intergenic
999702940 5:154244819-154244841 TTTTCTAGGCAAATGGAGGTTGG + Intronic
1001383211 5:171317427-171317449 AAGTCTAGGCAGATGGAGCCAGG - Intergenic
1002885524 6:1290355-1290377 CGTTGGAGGCACATGCAGCTGGG - Intergenic
1004111179 6:12720475-12720497 GGTTTTCAGCAGATGGAGCTGGG + Intronic
1018236396 6:161728189-161728211 AGTTCTCAGCAGGTGGAGCTAGG + Intronic
1018860224 6:167705875-167705897 CCTTCTAGGAAGCTGGGGCTGGG - Intergenic
1019050942 6:169183161-169183183 CGGTGTAGGCAGAGGGAACTCGG - Intergenic
1020274281 7:6615468-6615490 CGCTCTAGGCAGCCGCAGCTCGG - Intergenic
1022107200 7:27205104-27205126 CGTTAGAAGCAGAGGGAGCTTGG + Intergenic
1027270797 7:76517517-76517539 AGTTCCAGGCAGAGGGACCTGGG - Intergenic
1027320558 7:77007347-77007369 AGTTCCAGGCAGAGGGACCTGGG - Intergenic
1027470084 7:78562807-78562829 CCTTCTAGGGAGATGCAGTTAGG - Intronic
1033529668 7:142249054-142249076 CTCTCTAGGGAGATGGGGCTGGG + Intergenic
1035403224 7:158581826-158581848 CGTTCAAGACAAATGCAGCTCGG + Intronic
1043097465 8:75993946-75993968 AGTTGTAGGCTGATGGAGCAAGG - Intergenic
1044067613 8:87718529-87718551 CGTTGTAAGCAGGTGGATCTAGG - Intergenic
1045548449 8:103149313-103149335 CTTTCTATGGAGATGGAGATTGG - Intronic
1050768417 9:9165413-9165435 CATTCTATGCAGATGAAGGTAGG + Intronic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1057817080 9:98303713-98303735 CGTGCTAGGCAGCTGGAGTGAGG - Intronic
1060660819 9:125404232-125404254 CTTCCTAGGCAGCTGGAGCTGGG + Intergenic
1061945330 9:133905543-133905565 GGGCCTAGGCAGCTGGAGCTGGG - Intronic
1062181922 9:135195521-135195543 CATTCAAGGCAGAGGGACCTGGG - Intergenic
1203572766 Un_KI270744v1:147374-147396 ACTTGTAGGCAGATGCAGCTGGG + Intergenic
1190392922 X:49950189-49950211 AGTGCTAGCCAGATGGAGTTTGG - Intronic
1190875220 X:54455492-54455514 GGTTCGAGGCAGATTGAGGTTGG + Exonic
1194060229 X:89187505-89187527 AGTTCTAAGCAGAAGGAACTGGG + Intergenic