ID: 1153626414

View in Genome Browser
Species Human (GRCh38)
Location 18:7025721-7025743
Sequence ATGACCAAGAGGAATCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153626410_1153626414 17 Left 1153626410 18:7025681-7025703 CCCACTGGTAAGTAGACAACATA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 265
1153626407_1153626414 28 Left 1153626407 18:7025670-7025692 CCACCTCCTAGCCCACTGGTAAG 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 265
1153626408_1153626414 25 Left 1153626408 18:7025673-7025695 CCTCCTAGCCCACTGGTAAGTAG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 265
1153626409_1153626414 22 Left 1153626409 18:7025676-7025698 CCTAGCCCACTGGTAAGTAGACA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 265
1153626411_1153626414 16 Left 1153626411 18:7025682-7025704 CCACTGGTAAGTAGACAACATAT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153626414 Original CRISPR ATGACCAAGAGGAATCAAGA GGG Intronic
900631938 1:3641185-3641207 ATGACCCAGAGCACTCAGGAGGG + Intronic
900764547 1:4495031-4495053 AAGACTGAGAAGAATCAAGATGG - Intergenic
901551066 1:9996721-9996743 ATGACCAGGAGGTAACAAGCAGG + Intergenic
902355808 1:15899020-15899042 ATACCCAAGAGAAATGAAGACGG - Intronic
902977874 1:20101926-20101948 AGCTCCAAGAGGAATCAACACGG + Intergenic
903159436 1:21474915-21474937 ATGAGCAAGAGGAAGAAAAAGGG + Exonic
903311189 1:22457875-22457897 AGGAGCAAAAGGAGTCAAGAAGG - Intronic
904390578 1:30183000-30183022 ACGACCAACAGGAGTCAAGGAGG - Intergenic
907588108 1:55639633-55639655 ATAACTGAGAGGAGTCAAGAAGG + Intergenic
908485771 1:64591359-64591381 ATGACCAGGAGCACTGAAGAGGG + Intronic
910721485 1:90291371-90291393 AAGCCTGAGAGGAATCAAGATGG + Intergenic
911543864 1:99191792-99191814 AAGGCCAAAAGGAATCAAAATGG + Intergenic
912005766 1:104898666-104898688 TTGACCAAAAGGAATAAAGCTGG - Intergenic
912349000 1:108993337-108993359 AAGACAATGAGGAATCAAGATGG + Intronic
913108018 1:115632707-115632729 ATAACCAATAGGAAGCAACAAGG - Intergenic
914870470 1:151469892-151469914 ATGATAAAGAAGAATCCAGAGGG + Intergenic
915528117 1:156488492-156488514 GGGACCAGGGGGAATCAAGAAGG + Intronic
916244176 1:162670626-162670648 ATGCCCAGGAGGAAACTAGAGGG - Intronic
918234153 1:182562241-182562263 AGGAGCAAGAAGAATCCAGAGGG + Intergenic
918994629 1:191740915-191740937 CTGACCAAGAGAAAGAAAGAAGG + Intergenic
919545264 1:198909560-198909582 GTCACCAAGAGCAATCAAGATGG - Intergenic
920224050 1:204425079-204425101 AGGAACAAGAAGAATCCAGAGGG + Intronic
920532725 1:206715862-206715884 ATGACTAAGAGGATACAAAAAGG - Intronic
921304587 1:213783037-213783059 AAGACCAAGAGGTATGAACAGGG + Intergenic
922195539 1:223356669-223356691 ATGACAAAGAGGAAACAAAGAGG + Intronic
923074141 1:230594298-230594320 CTGACCCCCAGGAATCAAGATGG + Intergenic
924088217 1:240476412-240476434 ATGAACAAGAGGAATCTCTATGG + Intergenic
1065866948 10:29922517-29922539 ATGAGTAAGAGGAATCAAATAGG + Intergenic
1066315818 10:34245487-34245509 AGGACTAAGAGGGATCAAGGGGG + Intronic
1066411002 10:35169205-35169227 ATGAACAGGAAGAATCAATATGG - Intronic
1067942877 10:50670707-50670729 ATGCCCCAGAGGAATCAGCAGGG + Intergenic
1068527910 10:58151997-58152019 ATTATCAAAAGCAATCAAGAAGG - Intergenic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070864119 10:79695671-79695693 ATGCCCCAGAGGAATCAGCAGGG + Intergenic
1071631015 10:87217897-87217919 ATGCCCCAGAGGAATCAGCAGGG + Intergenic
1072868295 10:99087993-99088015 ATGAACAAGGGGAATCTAGTAGG - Intronic
1073245562 10:102087883-102087905 ATGACCAGCAGGAAGCAAGCAGG - Intergenic
1073281755 10:102359643-102359665 ATGGGCAATAGGAAGCAAGAAGG + Intronic
1073672762 10:105610436-105610458 GTCACCATGAGGAAGCAAGAAGG - Intergenic
1078585484 11:12583308-12583330 ATTATCAAGAGAAATCAATAAGG + Intergenic
1080084344 11:28259932-28259954 GTGAGGAAGAGGAGTCAAGAAGG - Intronic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1082803557 11:57432070-57432092 ATTACTAATAGGAATGAAGATGG + Intergenic
1083818479 11:65151567-65151589 ATGACTTTGAGAAATCAAGAAGG + Intergenic
1086726298 11:90188954-90188976 ATGACAAAGAGGAATTAAGGTGG + Intronic
1087059487 11:93963811-93963833 TTGACCAATAGGCATCAAAATGG - Intergenic
1088523925 11:110730852-110730874 ATGAGCAAGATGAAACAAAATGG + Intergenic
1089186882 11:116623629-116623651 ATGACAAAGAAGAATAAAGTAGG + Intergenic
1089841953 11:121426187-121426209 ATGGGCAAGAGGAAGCAAGTAGG - Intergenic
1091596799 12:1883826-1883848 GGGACCAAGAGGGATCAGGATGG - Intronic
1092070353 12:5626719-5626741 ATGCCCAGGAAGAACCAAGAGGG + Intronic
1095985456 12:47996328-47996350 GTGACTAAGAAGAATGAAGATGG - Intronic
1097947362 12:65385773-65385795 ATAATAAAGAGGAAACAAGATGG - Intronic
1099634998 12:85202539-85202561 AAGACCAAGAAGGATAAAGAAGG - Intronic
1101039450 12:100739683-100739705 GTGAACAAGAGCCATCAAGAGGG + Intronic
1101062296 12:100984755-100984777 GTGAAAAAGAGGAAGCAAGAAGG - Intronic
1101880232 12:108621380-108621402 ATTACCAAGAGGAAACATCAGGG - Intergenic
1103633456 12:122282353-122282375 ATTACCAAAAAAAATCAAGAAGG + Intronic
1103740721 12:123089554-123089576 AAGACAAAGATGAATAAAGATGG + Intronic
1104433176 12:128733196-128733218 ATGATCAAGAAGCTTCAAGATGG - Intergenic
1104785262 12:131444667-131444689 AGGAGCAAGAGGAAACAAGGAGG + Intergenic
1105667287 13:22574729-22574751 ATTACCAAGAGGAGCCAAGATGG + Intergenic
1105984370 13:25550716-25550738 AGGACCAAGAAGAGTCAGGAAGG - Intronic
1106513284 13:30430075-30430097 ATGACAAAGAGAACTCAAGAAGG - Intergenic
1106715174 13:32381084-32381106 ATGACCAAGATGAAATAAAATGG - Intronic
1109191755 13:59333078-59333100 AGGACCAAAAGGAAGTAAGATGG + Intergenic
1109239337 13:59864599-59864621 AAGACCAAGAGCAATCCAGTTGG - Intronic
1109263479 13:60170157-60170179 ATTACCAAGAGGAAACATCAGGG + Intergenic
1109412997 13:61998653-61998675 ATGACCAAGAGAAATAAGGTAGG + Intergenic
1109897202 13:68708757-68708779 ATGACCTAGAAGAAACAGGAAGG - Intergenic
1111918190 13:94383418-94383440 GTGATCAAAAGGAAACAAGAAGG + Intronic
1113076276 13:106470795-106470817 ATGAGCAAGAGGAATCCAATGGG - Intergenic
1113354464 13:109565352-109565374 ATGGCCAGGAGCACTCAAGATGG - Intergenic
1115749789 14:36477646-36477668 ATGGCAAACAGGAGTCAAGAGGG + Intronic
1115872252 14:37817668-37817690 ATGTCAAAGTGGAATCAAGCAGG + Intronic
1116172214 14:41417390-41417412 ATGACCATGAAAAATCAATAAGG + Intergenic
1117294061 14:54362791-54362813 ATGACCAGGAGGAAGCAGGCAGG + Intergenic
1118035420 14:61861017-61861039 AGGACCAGGAAGAATCAAGTTGG + Intergenic
1118897995 14:69962997-69963019 AGGACCAAGACAATTCAAGATGG - Intronic
1119803034 14:77462474-77462496 TTGACAGAGAGGACTCAAGAAGG + Intronic
1119923697 14:78471641-78471663 ATGATCAAGAGAAATAACGAGGG - Intronic
1119954173 14:78777427-78777449 ATAAAACAGAGGAATCAAGATGG - Intronic
1123098876 14:105781689-105781711 GTGACCAATAGGAATTAAGAAGG - Intergenic
1124613923 15:31228143-31228165 ATGAAAAAGAGGAAGCTAGAGGG + Intergenic
1124863476 15:33466164-33466186 GTAACCAAATGGAATCAAGAAGG + Intronic
1127104578 15:55599363-55599385 ATGACAAACAGTGATCAAGATGG - Intergenic
1127908541 15:63395886-63395908 ATGACCACAATGAGTCAAGATGG + Intergenic
1128565021 15:68695354-68695376 ATGACAAAGAGGAGGGAAGAAGG - Intronic
1130166230 15:81461751-81461773 ATTAGGAAAAGGAATCAAGATGG - Intergenic
1131180856 15:90238730-90238752 ATGACCAATTGGAATCACTATGG + Intronic
1131234642 15:90685063-90685085 AGGACCAGGAGGAAGCAAGTAGG + Intergenic
1131597427 15:93812784-93812806 CTTACCAAGAGGAAACAAAAGGG + Intergenic
1131969986 15:97882090-97882112 ATGAACCAGAAGAATCAAAAAGG - Intergenic
1132226854 15:100149476-100149498 GTGACCAGGATGAATCAGGACGG - Intronic
1133282239 16:4673366-4673388 ATGACAAAGAGAAGTCCAGAGGG - Intronic
1134111920 16:11520710-11520732 GTGACCAAGAGGAAGTATGAAGG + Intronic
1134240901 16:12505901-12505923 ATGATCAAAAGAAATAAAGAAGG - Intronic
1134332973 16:13267254-13267276 ATCACAAGGAGGAATCAAAATGG + Intergenic
1137882868 16:52070574-52070596 ATAACCAGGAAGAAGCAAGAAGG - Intronic
1138847155 16:60580244-60580266 AAGACCAAGTGAAACCAAGATGG + Intergenic
1140133509 16:72184750-72184772 AAGACAAAGAAGAATCAAGATGG - Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143684560 17:8503678-8503700 ATGACCCAGAGCAACCAGGAGGG - Intronic
1144132364 17:12259190-12259212 GTGCTCAAGAGGAAGCAAGAAGG + Intergenic
1144343992 17:14333677-14333699 ATTACTAAGAGGAATCATCAGGG + Intronic
1144687198 17:17234029-17234051 ATAACCAAGAGTAAGAAAGATGG - Intronic
1146197134 17:30823559-30823581 ATGACCCAGAGAAATTCAGATGG + Intronic
1146582921 17:34055528-34055550 TTGATTAAGAGGAAACAAGAAGG - Intronic
1146670048 17:34731033-34731055 ATGGCCAAGAGGAGTCACCACGG - Intergenic
1147986647 17:44310824-44310846 ATGACCAGGGGAAATCAAGCTGG + Intronic
1148541778 17:48486685-48486707 ATGACTAACAGGATTCAACATGG - Intergenic
1149153901 17:53603248-53603270 ATGATCAAAAAGAATAAAGAAGG - Intergenic
1149702635 17:58668160-58668182 ATTACCAAGAGGAAACATCAGGG - Intronic
1151112192 17:71691303-71691325 ATGACCAAGAGGCAAAAAGAAGG + Intergenic
1151420549 17:73994252-73994274 ATGACCTAGAGGGTTCAGGAGGG + Intergenic
1203192519 17_KI270729v1_random:202981-203003 ATGACCAAGAAGATTTGAGAAGG - Intergenic
1203201884 17_KI270730v1_random:2416-2438 ATGACCAAGAAGATTTGAGAAGG - Intergenic
1153626414 18:7025721-7025743 ATGACCAAGAGGAATCAAGAGGG + Intronic
1155117141 18:22780103-22780125 ATAACCATAAGGAAACAAGAAGG + Intergenic
1155720192 18:29001726-29001748 ATTTCCAAGAGGACTGAAGATGG - Intergenic
1156395929 18:36699935-36699957 AGGACAAAGAGGCATCCAGAGGG - Intronic
1156638157 18:39056021-39056043 AAGCCCAAGAGGAAGCCAGAAGG + Intergenic
1156702355 18:39841058-39841080 ATTATCAAGAGGAACAAAGAAGG - Intergenic
1158797786 18:60868988-60869010 ATGACCAAGAGATTTAAAGAAGG + Intergenic
1159268448 18:66115848-66115870 ATTAGCAAGATAAATCAAGAAGG + Intergenic
1159293649 18:66453666-66453688 ATGACCCTGAGAAATAAAGAAGG - Intergenic
1159469489 18:68832897-68832919 GTGACAAAGAGGAAGCCAGAGGG + Intronic
1165162225 19:33823541-33823563 ATGCCCAACAGGAAGCCAGAGGG - Intergenic
1165666911 19:37638830-37638852 ATGACCGAAAGAAGTCAAGAGGG + Intronic
1166575840 19:43836986-43837008 ATTTCCAAGAGGAAAAAAGAGGG - Intronic
1167117694 19:47497729-47497751 ATGACCAAGTGTAACCAGGAAGG - Intronic
925690681 2:6520035-6520057 AACACCAGGAGGAATTAAGAAGG + Intergenic
926481526 2:13402796-13402818 ATGATCAAGTGGAATTAAGATGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926875786 2:17477214-17477236 AAGAACAAGAGGAATAAAGCAGG + Intergenic
927064807 2:19460634-19460656 ATTACCAAGAGGAAACATCAGGG - Intergenic
929720912 2:44366502-44366524 ATTACCAAAAGGATTCAAGATGG - Intronic
930542628 2:52726024-52726046 AGGACAAAAAGGAATCAAGTTGG - Intergenic
931153092 2:59597064-59597086 ATGAGCAAAATGAATGAAGAAGG - Intergenic
931617067 2:64170147-64170169 ATGACCAAGAAGTATCCAAAAGG - Intergenic
933363752 2:81322627-81322649 ATGACCAACAATGATCAAGAAGG - Intergenic
935274253 2:101462704-101462726 ATGATGAAGTGGAAACAAGATGG + Intronic
936710250 2:115122921-115122943 GTGACCAAGAGGAATCATTCTGG + Intronic
937756704 2:125547881-125547903 ATGACCAAAAAGGACCAAGAAGG + Intergenic
937953434 2:127405776-127405798 AAAACCAAGAGTAATTAAGATGG - Intergenic
938814688 2:134888856-134888878 ATGACCAAGAAGGAGCATGAGGG + Intronic
939427990 2:142065591-142065613 ATGACAAAGGGGAATTAAGGTGG - Intronic
940391284 2:153135369-153135391 ATGACCAGGAATAACCAAGATGG + Intergenic
941499010 2:166245431-166245453 ATGAACAAGAAGGACCAAGAGGG + Intronic
941914436 2:170800801-170800823 ATGACCAAAAGAAATGAAGATGG + Intergenic
943017991 2:182537662-182537684 ATGAACAAGAAAAATTAAGAAGG + Intergenic
943603377 2:189947746-189947768 ATCACCAAGAGTAATCTATATGG - Intronic
943660198 2:190551944-190551966 AATACCAAGTGGAATCAAAATGG - Intergenic
945392235 2:209278199-209278221 TTGACCAAGAGGAGAGAAGAGGG - Intergenic
945629947 2:212261679-212261701 ATGACCTAGAGAAGTTAAGATGG + Intronic
946953697 2:224905684-224905706 ATGCCAAAGAAGAATCAAGATGG - Intronic
948318530 2:237049825-237049847 ATGACCAGGAGGCATACAGAGGG - Intergenic
1170833337 20:19862150-19862172 ATTACCAAGAGGAAACATCAGGG - Intergenic
1172606788 20:36219464-36219486 ATGACCAAAAGGATCCAAGGTGG - Intronic
1174402728 20:50284563-50284585 ATGACCAAGAGAGACAAAGATGG - Intergenic
1174668823 20:52286350-52286372 ATGAACAAGAGGGAGCATGAAGG - Intergenic
1174954874 20:55086515-55086537 CCCACCATGAGGAATCAAGAAGG + Intergenic
1178258332 21:31075611-31075633 GTGGCCAAGAAGAAGCAAGATGG - Intergenic
1178479452 21:32967083-32967105 ATTACCAAGAAGAAACATGAGGG + Intergenic
1178694427 21:34780808-34780830 ACAATCAAGATGAATCAAGATGG + Intergenic
1180845868 22:18981821-18981843 ATCACAAAGAGGAATTAAGCAGG + Intergenic
1180930040 22:19583685-19583707 GTGACCAGGAGGAGTCATGAGGG + Intergenic
1181332124 22:22100940-22100962 ATGACCCAGAGGGATAAAGGTGG + Intergenic
1181758251 22:25040336-25040358 ATGACCAAGAGAAACCAAAGTGG - Exonic
1182399393 22:30063125-30063147 AAGTCCTAGAGGAAGCAAGAGGG - Intergenic
949131256 3:503699-503721 ATGTCCAAGAGGAAGCATTAAGG - Intergenic
950640395 3:14344767-14344789 ATGCCCAAGAGGAATGGAGGGGG + Intergenic
950850698 3:16059676-16059698 AAGACAAAGAGGAATCCATAAGG - Intergenic
952082192 3:29772659-29772681 ATTACCAAGAGGAAGCATCAGGG + Intronic
953579817 3:44143925-44143947 GTGAGCAAGAGGAACCCAGAGGG + Intergenic
953581314 3:44159592-44159614 ATGACAAAGAAGAATAAAGTGGG - Intergenic
953676512 3:45007055-45007077 ATGGCAAGGGGGAATCAAGAGGG - Intronic
956362859 3:68467623-68467645 ATTACCAAGAGGAAACATCAGGG + Intronic
959349619 3:105245439-105245461 ATGACCAAGAAGTTTCAAAATGG + Intergenic
960749184 3:120927423-120927445 ATGACAAAGAGAAACAAAGAGGG - Intronic
960876050 3:122296221-122296243 ATGACTAAGAGGAAACATCAGGG - Intergenic
964668746 3:159202557-159202579 AGGACCAAGAGGAACCATGAAGG - Intronic
966295437 3:178415622-178415644 ATGTCCAAGAGTAGTGAAGATGG - Intergenic
966745347 3:183269684-183269706 ATGACCAACATGTATTAAGATGG + Exonic
970928289 4:21478682-21478704 AAGTCCAAGAGAAAGCAAGACGG + Intronic
971810629 4:31421144-31421166 ATGAGCAAGGGGAACAAAGATGG - Intergenic
972324766 4:38005070-38005092 ATAACCAAGAAGATGCAAGACGG - Intronic
972819170 4:42679786-42679808 ATGAACAATAGGAATGAAAAGGG + Intergenic
975363047 4:73494247-73494269 AAAACCAAGATTAATCAAGAAGG + Intronic
977993648 4:103476209-103476231 ATGACTAAGAGGAAGCATCAGGG + Intergenic
978838553 4:113182858-113182880 AAGAGGAAGTGGAATCAAGAAGG + Intronic
979173485 4:117631920-117631942 TTGAGCAAGAAGAATAAAGATGG + Intergenic
979937109 4:126711664-126711686 AAGTCCTACAGGAATCAAGAAGG + Intergenic
980545356 4:134254860-134254882 ATTACCAAAAGGCATCAAGGAGG - Intergenic
981661743 4:147175464-147175486 ATAACAAAGAGTAATTAAGATGG + Intergenic
983533782 4:168836149-168836171 ATGACTACGAGGAAACAAGATGG + Intronic
983615424 4:169699071-169699093 ATGGCAAGGAGGAATCAAGGTGG - Intronic
984379358 4:178970699-178970721 AAGCCCAAAAGGAATGAAGAAGG - Intergenic
986752464 5:10801070-10801092 CTGACCAAGAGAAAGGAAGAAGG + Intergenic
987366749 5:17155489-17155511 ATGGACCAGAGGAATCCAGAGGG - Intronic
987966271 5:24880033-24880055 GTGAGCAAGAGGGCTCAAGATGG - Intergenic
989511353 5:42291423-42291445 AGAACCAATAGGAATCATGATGG - Intergenic
990734612 5:58846341-58846363 CTGAACAATGGGAATCAAGAGGG - Intronic
990881860 5:60547669-60547691 AGAACCAGGAAGAATCAAGAAGG - Intergenic
991426887 5:66500859-66500881 ATTTCCATGAGGAGTCAAGAGGG - Intergenic
992376234 5:76190404-76190426 ATTACCAAGAGGAAACATTAGGG + Intronic
993903540 5:93600089-93600111 ATGACCAAGAGAAAGAAAGCGGG - Intergenic
995005869 5:107194748-107194770 ATGACCAAGAGAATTCCTGAAGG - Intergenic
995020627 5:107363179-107363201 ATGACCAAGAGGTTTCCATAAGG + Intergenic
995899896 5:117053180-117053202 ATGAATAAGAGAAATCTAGAAGG - Intergenic
997367516 5:133335442-133335464 CTGCCCAGGAGGAATCAAGATGG + Intronic
997485625 5:134227749-134227771 AAGACCAAGTGGAATGAATAAGG + Intergenic
998012104 5:138703621-138703643 ATGAACAAGAGAAAGAAAGAAGG - Intronic
999138519 5:149340485-149340507 ATGCCCAATATGAATCAAGTTGG - Exonic
999389281 5:151178445-151178467 AGGACCAAGAGCAATCATGGTGG + Intergenic
999806603 5:155087155-155087177 ATGCCCCAGGGGAATCCAGAGGG + Intergenic
1003076603 6:2988536-2988558 ATGACCAAGGGAAATGAAGGCGG + Intronic
1005650646 6:27881910-27881932 AAGACAAAGAGAAATCAAGAAGG - Intergenic
1006079543 6:31557545-31557567 GTGACCAGCAGGATTCAAGATGG + Intronic
1006244925 6:32724491-32724513 ATGAACTGTAGGAATCAAGAAGG + Intergenic
1006352437 6:33531341-33531363 ATGTACAAGAGGAAACCAGATGG + Intergenic
1006415712 6:33902739-33902761 ATCACCAAGAGGAATTAGAATGG + Intergenic
1007911603 6:45520599-45520621 ATGCCCAAGAGGGAACAACAGGG - Intronic
1008250789 6:49237593-49237615 AGGACCCAGAGAAATAAAGATGG - Intergenic
1008290875 6:49714250-49714272 ATGACCTAGAGGAAGAGAGATGG + Intergenic
1008784381 6:55148317-55148339 ATGACCAAAAGAATTCTAGAGGG + Intronic
1009814566 6:68715458-68715480 ATGAGCAAGAGGAATGGAGAAGG + Intronic
1014231927 6:118913557-118913579 ATGACCAACAGGATTAAAGGAGG + Intronic
1016200336 6:141399156-141399178 ATTATGAAGAGGAATCAACAGGG - Intergenic
1016950441 6:149574441-149574463 GGGACAAAGAGGAAACAAGAAGG - Intronic
1018226379 6:161633283-161633305 ATGACAAACTGGAATCATGAGGG - Intronic
1019026342 6:168967178-168967200 ATGAACAAGAGGAAAAAAAAAGG - Intergenic
1019364245 7:623612-623634 ATGACCGAGAGGAAACACCAGGG - Intronic
1020903034 7:14029299-14029321 AAAACCAAAAGGAATCAGGAAGG - Intergenic
1021953910 7:25804484-25804506 ATGACCAAGAGAAATGAACGGGG - Intergenic
1026408956 7:70099078-70099100 ATGACTAAAAGGAATCATGACGG - Intronic
1028877326 7:95837977-95837999 AGGACCAGGAGGAGCCAAGATGG - Intronic
1031207435 7:118778533-118778555 ATCAACAAGAGGAATAGAGAAGG + Intergenic
1031552481 7:123132268-123132290 AGCAGAAAGAGGAATCAAGAGGG + Intronic
1032488159 7:132303967-132303989 ATGACCAAGAGCTACCAATATGG + Intronic
1037226880 8:16603043-16603065 ATGGCAAAGAGGAATTAAGGTGG + Intergenic
1039716621 8:40116657-40116679 ATGACAAAGAAAAATAAAGAGGG + Intergenic
1039733945 8:40309736-40309758 ATTACCAAGAGGAAACATGAGGG - Intergenic
1040894939 8:52356069-52356091 ATGTACACAAGGAATCAAGAAGG + Intronic
1043360746 8:79469080-79469102 ATGACCAACTGGACTCAACATGG - Intergenic
1043787949 8:84425558-84425580 AAGACCAGGAGGAGCCAAGATGG - Intronic
1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG + Intronic
1047711153 8:127553758-127553780 ATGTCCCAGAGGCATCCAGAAGG + Intergenic
1048652126 8:136489667-136489689 ATGACCAAGAGAATTAAGGAGGG - Intergenic
1050639678 9:7654119-7654141 ATCTTCTAGAGGAATCAAGATGG - Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1052010378 9:23400412-23400434 TTGAGCAAGAGGAATAAAGCTGG + Intergenic
1052184928 9:25581535-25581557 AGGATCATGAGGAATCAAGTGGG + Intergenic
1054919035 9:70523332-70523354 ATGACCAACAAGAATCACAATGG - Intergenic
1054938885 9:70718159-70718181 ATGACCAAGAGATCTGAAGACGG + Intronic
1054940576 9:70736152-70736174 ATGACCAAGAGATCTGAAGACGG + Intronic
1054952409 9:70867319-70867341 ATGAGCAAGAGAAATAAGGAAGG - Intronic
1055749409 9:79488237-79488259 CTGAACAAGTGAAATCAAGAGGG - Intergenic
1055789604 9:79909687-79909709 TTGAACAAGAGGAACCAAGTTGG + Intergenic
1056835785 9:89954115-89954137 CTGACCCAGAGGATTCTAGAGGG - Intergenic
1057544296 9:96005821-96005843 ATGAACAAGGGGTAACAAGAAGG + Intronic
1057941100 9:99285575-99285597 ATTAGCAAGAGGAAAAAAGAGGG - Intergenic
1057961448 9:99461375-99461397 ATGATCCAGAGGAAGCAATAAGG - Intergenic
1059049496 9:110908480-110908502 ATGTTCAAGAGAAATCAAAAGGG + Intronic
1060475807 9:123985709-123985731 ATGACCCAGTGGAATGAACAAGG + Intergenic
1060990995 9:127848998-127849020 ATGACCAGGATGAGTCAGGATGG - Intronic
1061225835 9:129280607-129280629 AAGACCGAGAGGAGTCAAGGTGG + Intergenic
1061449070 9:130659096-130659118 ATCACCAAGAGGGAGCAACAGGG - Intergenic
1186236179 X:7513421-7513443 ATGGACAAGAGGAAACATGACGG + Intergenic
1186264118 X:7813177-7813199 ATGACCAGGAGACATCATGATGG + Intergenic
1186367208 X:8907984-8908006 ATCAACAAGATCAATCAAGATGG + Intergenic
1188145144 X:26602721-26602743 ATGAGGAAGAGGAACCCAGAGGG - Intergenic
1188782676 X:34304961-34304983 ATGACCAAAGGGGATAAAGATGG + Intergenic
1189127598 X:38464323-38464345 ATCACCAAGTGGAATATAGAAGG + Intronic
1190849620 X:54225898-54225920 ATAAACTATAGGAATCAAGATGG + Intronic
1191137866 X:57085110-57085132 ATGATCAAGAAGGATAAAGAAGG + Intergenic
1191971533 X:66822393-66822415 AAGACCAAGATGAACCAAGATGG + Intergenic
1192093572 X:68186365-68186387 ATTACCAACAGAAATCAAGAGGG + Intronic
1192296044 X:69849428-69849450 AGGAGCAAGTGGAATCAACATGG - Intronic
1192555948 X:72089424-72089446 ATGGGCAAGAGGATTCCAGAGGG + Intergenic
1194262285 X:91711107-91711129 ATTACCTAGAGGAGTCAGGAAGG + Intergenic
1195739912 X:108053176-108053198 ATGATAAAGAGCAATCAGGAAGG + Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196362253 X:114875831-114875853 AGAAGCAAGAGGAATCAAGATGG - Intronic
1196895261 X:120329864-120329886 ATTACCAAGAGGAAGCAGCAGGG - Intergenic
1197766966 X:130065659-130065681 ATGTCAAAAAGTAATCAAGAGGG + Exonic
1197966300 X:132066001-132066023 AAGAACAAGAGGAAATAAGAGGG + Intergenic
1197967732 X:132082876-132082898 ATGACCAACAGGAAACAGGAGGG + Intronic
1200581579 Y:4955940-4955962 ATTACCTAGAGGAGTCAGGAAGG + Intergenic
1201324039 Y:12734288-12734310 ATGAACTGGAGGAATCAAGAGGG - Intronic
1201453427 Y:14141812-14141834 ATGACCAGGAGAAGTCAAGACGG - Intergenic