ID: 1153631112

View in Genome Browser
Species Human (GRCh38)
Location 18:7070842-7070864
Sequence CCGGCTTTAAAAGTTTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153631110_1153631112 -8 Left 1153631110 18:7070827-7070849 CCACTGAAATGTTCTCCGGCTTT 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1153631112 18:7070842-7070864 CCGGCTTTAAAAGTTTTTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 172
1153631107_1153631112 0 Left 1153631107 18:7070819-7070841 CCTCACTCCCACTGAAATGTTCT 0: 1
1: 0
2: 0
3: 29
4: 269
Right 1153631112 18:7070842-7070864 CCGGCTTTAAAAGTTTTTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 172
1153631106_1153631112 1 Left 1153631106 18:7070818-7070840 CCCTCACTCCCACTGAAATGTTC 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1153631112 18:7070842-7070864 CCGGCTTTAAAAGTTTTTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 172
1153631109_1153631112 -7 Left 1153631109 18:7070826-7070848 CCCACTGAAATGTTCTCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1153631112 18:7070842-7070864 CCGGCTTTAAAAGTTTTTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153631112 Original CRISPR CCGGCTTTAAAAGTTTTTTA AGG Intronic
901771689 1:11533805-11533827 CCTGCTCTAAAAGATTCTTAAGG - Intronic
903434801 1:23340012-23340034 CCAGATTTAAAAATTTTTTAAGG + Intronic
903549604 1:24148835-24148857 CCGGCCTGCAAAGGTTTTTAAGG - Intergenic
906457238 1:46007666-46007688 CCAACTTTGAAATTTTTTTAAGG + Intronic
909169463 1:72276675-72276697 CTGGATGTAATAGTTTTTTAAGG - Intronic
909707556 1:78605554-78605576 CTGGCTTCAAAAGTGTTTTCCGG + Intergenic
910987910 1:93024481-93024503 CCTGCTTTCTGAGTTTTTTAAGG + Intergenic
914767125 1:150648315-150648337 CCGGCTTTAAGATTTATTGAAGG + Exonic
914989696 1:152487705-152487727 CTTGCTTTACTAGTTTTTTAAGG + Intergenic
918665905 1:187150847-187150869 CTTGCTTTTATAGTTTTTTAAGG + Intergenic
923155840 1:231278777-231278799 CCGGCCTCAAAAGTCTCTTAAGG + Intergenic
923438689 1:233994675-233994697 CCTGGTATAAAAGTATTTTATGG + Intronic
1065209667 10:23390519-23390541 CCTGCTCTAAAATTTTTTTTTGG - Intergenic
1065270816 10:24031628-24031650 ACAGCTTTAAAAATTATTTAAGG - Intronic
1068582517 10:58758145-58758167 CCGTCATTAAAAATTTTTTTTGG + Intronic
1069135808 10:64763780-64763802 CCAGCTTTAAAAATTGGTTATGG - Intergenic
1069584678 10:69590598-69590620 TCAGCTTTCAAAGTATTTTAGGG + Intergenic
1069947119 10:71995126-71995148 CCGGCTGGAAAAGTTCTTGAAGG - Intronic
1072680556 10:97503210-97503232 CCAGCCTTAAAAATTTTTTTTGG + Intronic
1074124850 10:110520353-110520375 CCCCCTTTAATAGTTTCTTAAGG + Intergenic
1079921554 11:26439638-26439660 TCGGAGTTAAAAGTTTTTAAAGG - Intronic
1081813687 11:45927175-45927197 CTGGCTCTAAAAGTATTTGAAGG + Intronic
1085947754 11:81292242-81292264 CTGTGTTTAAAAATTTTTTAAGG + Intergenic
1085976974 11:81667954-81667976 CCGTCTTTAAAAGTAGTTGAAGG - Intergenic
1086172355 11:83850878-83850900 CCGGCCTCAAAATTTCTTTAGGG - Intronic
1086579379 11:88380316-88380338 TCGGCTTTAACAGTTTTTGGTGG - Intergenic
1086748940 11:90465984-90466006 ACTGCTTCTAAAGTTTTTTATGG + Intergenic
1086983375 11:93223173-93223195 CAGACTTTAAAAGTTTTTTCTGG - Intergenic
1087211880 11:95453317-95453339 CCCCCTTAAAATGTTTTTTAAGG + Intergenic
1089936993 11:122375011-122375033 CTGGCTTTCAAGGTTTTTTAGGG - Intergenic
1094744573 12:33329904-33329926 TCAGTTTTAAAAGTTTTATAGGG - Intergenic
1095624053 12:44294134-44294156 CTGGTTTTCAAGGTTTTTTATGG + Intronic
1097146355 12:56942157-56942179 CCTGCTATAATAGTTTTTTGGGG + Intergenic
1097148465 12:56958170-56958192 CCTGCTATAATAGTTTTTTGGGG + Exonic
1101774211 12:107778956-107778978 AAAGCTTTATAAGTTTTTTATGG + Intergenic
1102488750 12:113276255-113276277 CTGTCTTTAAAAATGTTTTAAGG - Intronic
1104828196 12:131729976-131729998 TCAGCTTTAAAAGGTTTTTGGGG - Intronic
1105478806 13:20754610-20754632 CCGGCTTTTAAAAATTTTTCAGG - Intronic
1105995200 13:25664541-25664563 CTGGCTTGAACAGTTTCTTAGGG - Intronic
1107775948 13:43841198-43841220 CAAGCTTTACAACTTTTTTAAGG + Intronic
1111288627 13:86130823-86130845 TTGTCTTTAAAAGTTTTTTTAGG - Intergenic
1115067951 14:29288038-29288060 CATGCTTTAAAAATGTTTTAAGG + Intergenic
1115116573 14:29887561-29887583 CTGGATTTAAAATTATTTTAGGG - Intronic
1118781278 14:69009732-69009754 ACAGCTTTAAAAATTATTTAGGG + Intergenic
1120015203 14:79465742-79465764 GCTGCTTTAAAAGAGTTTTAAGG + Intronic
1120817387 14:88876715-88876737 CTGGTTTTAAAAGTTTATAAAGG - Intronic
1124151564 15:27183545-27183567 CAGCCTTCAACAGTTTTTTAAGG - Intronic
1124612815 15:31220180-31220202 CAGGCATTAAGAGTCTTTTAAGG - Intergenic
1125113177 15:36057759-36057781 CCTGCTCTACAAGTATTTTAAGG - Intergenic
1125319869 15:38474649-38474671 CAGGCCTTAAAAGTATCTTAAGG + Intronic
1126488423 15:49209213-49209235 TCAGCTCTAAAAGCTTTTTATGG + Intronic
1126510961 15:49474090-49474112 CAGGATTTAAAATATTTTTAAGG + Intronic
1129715675 15:77848510-77848532 CCAGTTTTAAAAGTTTTGGAAGG - Intergenic
1131625858 15:94119705-94119727 CAGGCTTTGAAAGGTTTGTAAGG - Intergenic
1131814013 15:96203625-96203647 CCAGCTTTAAAATTTCTTGAAGG - Intergenic
1132175253 15:99708998-99709020 TCTACTTCAAAAGTTTTTTATGG - Intronic
1135209801 16:20515327-20515349 AAGGCTTTAAATGTGTTTTAGGG - Intergenic
1140820752 16:78660731-78660753 CCATCATTAAAAGTTTGTTATGG + Intronic
1143890201 17:10097013-10097035 CTGGCTTGAAAAGTTTTTTGGGG - Intronic
1146984095 17:37197122-37197144 ACAGCTTTAAAACATTTTTAGGG - Intronic
1147729965 17:42593351-42593373 CTGGCCTCAAAATTTTTTTATGG - Intronic
1147954462 17:44124529-44124551 CAGACATTAAAAGTTTTATAGGG + Intergenic
1148708879 17:49661715-49661737 CCGGCCTTAAATATGTTTTATGG - Intronic
1150096061 17:62376460-62376482 CTTTCTTTAAAAGTTTTTTTAGG - Intronic
1150263316 17:63814493-63814515 CCTGTTTTAAAAGTTTATTTAGG - Intronic
1151634501 17:75336073-75336095 GCTACTTTAAAAGTTATTTAAGG + Intronic
1152490917 17:80632960-80632982 CACGCTTTTAAAATTTTTTATGG + Intronic
1152674374 17:81630579-81630601 CCATTTTTAAACGTTTTTTAGGG - Intronic
1153631112 18:7070842-7070864 CCGGCTTTAAAAGTTTTTTAAGG + Intronic
1162669395 19:12242209-12242231 CCGGCCTTTAATTTTTTTTAAGG - Intronic
1164461287 19:28450887-28450909 CCGGGTAAAAAAGCTTTTTATGG + Intergenic
1164807062 19:31125202-31125224 CAGGCTTTGGAAGTTTTCTACGG + Intergenic
1165910469 19:39223173-39223195 CCCGTTTTTAAAGTTTTTTTGGG - Intergenic
1166211781 19:41311088-41311110 CCGGCCTTAAGACTTTTTTTAGG - Intronic
1167329497 19:48846154-48846176 CAGCCTTAAAAAGTTTTTAAGGG - Intronic
1167329498 19:48846155-48846177 CCAGCCTTAAAAAGTTTTTAAGG - Intronic
1167818862 19:51908009-51908031 CTGACTTTAAAAGTTGTTTGGGG + Intronic
928281902 2:29954134-29954156 CCGTCTTTTAAAGTTATTTCAGG + Intergenic
928510475 2:31998498-31998520 CTGGCTTTAAAAATCATTTATGG + Intronic
929542559 2:42833682-42833704 CAGGCTTAAAAAATTTTTTTTGG + Intergenic
930628248 2:53723096-53723118 CCAGGTTTAAAATTTTTTTTTGG - Intronic
931132839 2:59357561-59357583 CAAACTTTAAAAGTTTTTTTTGG + Intergenic
931322304 2:61182865-61182887 CTGGCTTTAATTTTTTTTTAAGG - Intronic
934903801 2:98181687-98181709 GCAGCTTTCAAAGTTTTTAATGG - Intronic
935836224 2:107057343-107057365 CCTGATTTAAAACTTTTTTGTGG + Intergenic
941667001 2:168252149-168252171 GTGGCTTTAAAAATTATTTATGG + Intergenic
942264529 2:174208540-174208562 TCGGCGTTAAAGCTTTTTTATGG + Intronic
943925691 2:193776028-193776050 CCAGTTTTAAGAGTTTTTTTTGG + Intergenic
943957100 2:194206788-194206810 ATTGCTTTAAATGTTTTTTATGG + Intergenic
947474375 2:230430087-230430109 CAGGCTTTATAAGTTTGTTTCGG + Intronic
1172927761 20:38554779-38554801 CTGGCTGTAAAATTGTTTTAAGG - Intronic
1175415346 20:58797202-58797224 CCGGCCTTACAAGTGTTTTCTGG + Intergenic
1175864593 20:62168483-62168505 CCGGCCTGGAAAGTTCTTTATGG - Intronic
1176317006 21:5255759-5255781 CCGGCTTAAGGAGTCTTTTAGGG + Intergenic
1178822169 21:35985221-35985243 GTGGATTTAAAAGTGTTTTAGGG - Intronic
1183788667 22:40046943-40046965 CCGACTTGAAAACATTTTTAAGG - Intronic
952150951 3:30590844-30590866 TCGTTTTTACAAGTTTTTTATGG + Intergenic
952381495 3:32808872-32808894 CCGGCCTTAAAATTTTTTTCTGG + Intergenic
953071174 3:39521443-39521465 CCCCCGTTTAAAGTTTTTTAAGG + Intronic
953794373 3:45972819-45972841 AAGGCTTTAAAATTTTTTTAAGG - Intronic
954450386 3:50568330-50568352 CCGGTTTTCAAAGTAGTTTATGG + Intronic
958043562 3:88255017-88255039 CAGTTTTTAAAAGATTTTTAGGG + Intergenic
962011279 3:131393212-131393234 ACGGCTTTAAAAGTTTTAGAAGG + Intergenic
962337016 3:134542971-134542993 CTGGCTTTAGAGGTATTTTAAGG - Intronic
964317774 3:155462474-155462496 CCATCTTTAAATGTTGTTTAGGG + Intronic
964556711 3:157947583-157947605 TTGTCTTTAAAAGTTTTTCATGG - Intergenic
965530559 3:169766230-169766252 CCAGGTTGTAAAGTTTTTTACGG + Intergenic
968986486 4:3878183-3878205 CCTGCTCTAAAAGTCTCTTAAGG - Intergenic
969699289 4:8757721-8757743 TGGGCTTTAAGAGTTCTTTATGG - Intergenic
970231909 4:13919638-13919660 CTGGCATTAACAGTTTTTAAAGG - Intergenic
972802187 4:42488580-42488602 CTTGCTTTAAAAATTTTCTAGGG + Intronic
973715478 4:53671411-53671433 CCAGTTTTAAAAATTTTTGATGG - Intronic
974410115 4:61529940-61529962 GTGGCTTTAAAAATATTTTATGG + Intronic
975334022 4:73154738-73154760 CCGTTATTAAATGTTTTTTAAGG - Intronic
975764079 4:77648970-77648992 ACTGCTTTAAAAGTTTATTGAGG - Intergenic
979617339 4:122758571-122758593 CAGGCTTTACAATTTTATTATGG + Intergenic
980940784 4:139272258-139272280 CCGGCCTAGAAATTTTTTTAAGG - Intronic
984942585 4:184946730-184946752 CCTGCTTTAAAAGGATTTAAGGG - Intergenic
985292237 4:188398413-188398435 CAGGATTTAAAAGAATTTTATGG - Intergenic
987329824 5:16846815-16846837 AGGGCATTAAAAGTTATTTAAGG + Intronic
988198528 5:28040296-28040318 CCTTCTTTAAAAAATTTTTATGG + Intergenic
991287978 5:65001201-65001223 CCAGCTCTAAAAGTGTTTTGTGG + Intronic
992462056 5:76970240-76970262 CCGGCTAGAAAATTCTTTTAAGG + Intronic
992702892 5:79358713-79358735 GAGGCTTTAAAAATTTTTTTAGG - Intergenic
993518805 5:88872699-88872721 CCACCTCTTAAAGTTTTTTAAGG - Intronic
994530416 5:100962661-100962683 TCAGTTCTAAAAGTTTTTTATGG - Intergenic
997515134 5:134482727-134482749 CCGGCCTGAATAATTTTTTAAGG + Intergenic
997553062 5:134770509-134770531 CCACCTGTAAAAGTATTTTAAGG + Intronic
998273923 5:140733526-140733548 CCAGCTTTTAAAGTTTTCTGGGG - Intergenic
1000666994 5:164010736-164010758 CTGCATTAAAAAGTTTTTTAAGG + Intergenic
1000783479 5:165513665-165513687 CAGTCTTTAACAGTTTGTTATGG - Intergenic
1000797292 5:165680481-165680503 CCGGCCTTAAAATCTTTTTATGG + Intergenic
1003428764 6:6019777-6019799 CAGGGTTTCAAGGTTTTTTAAGG - Intergenic
1003609589 6:7598192-7598214 CCTTCTTTAAAAATTTTTTTTGG + Intronic
1004113184 6:12741279-12741301 CCTGCTTAAAAATTTTTTGAAGG + Intronic
1006489387 6:34373611-34373633 CTGCCTTAAAAAGTATTTTATGG + Intronic
1007912158 6:45526870-45526892 CCTGCTTTAATAGGTTGTTATGG + Intronic
1008227004 6:48932892-48932914 CCAGTTTTAATAGTTTTTTGAGG + Intergenic
1008744506 6:54652949-54652971 CCAGATATAAAAGTTATTTATGG - Intergenic
1009943530 6:70317445-70317467 CTGTCTTTAAAAACTTTTTATGG + Intergenic
1010742203 6:79521417-79521439 ATGGCTTTAAAAATTTTTTTTGG - Intronic
1010962380 6:82160572-82160594 CAGGCTTGGGAAGTTTTTTATGG - Intergenic
1012062283 6:94503413-94503435 CTGGCTTTAATAGTTTTTGGTGG - Intergenic
1014513055 6:122348593-122348615 CCCACTTTAAAAGTTGTGTAGGG + Intergenic
1015837773 6:137440176-137440198 TGGGATTTAAGAGTTTTTTAAGG + Intergenic
1016318643 6:142818378-142818400 CCGGCTTTAAAAGCGTTGTATGG - Intronic
1021382138 7:19980866-19980888 CCTTCTATAACAGTTTTTTAGGG + Intergenic
1021906271 7:25336959-25336981 ACTGTTTTAAAAATTTTTTATGG - Intergenic
1022777994 7:33547336-33547358 ACGTCTTTAAATGTCTTTTAAGG - Intronic
1023498465 7:40823188-40823210 CTGGTATTAAAAGTTATTTAAGG - Intronic
1025707424 7:63880397-63880419 TAGGCTTCAAAAGTTTTATATGG + Intergenic
1025992935 7:66509480-66509502 CCAGCCTAAAAAGATTTTTAAGG + Intergenic
1026036791 7:66835898-66835920 CCAGCCTAAAAAGGTTTTTAAGG - Intergenic
1026201017 7:68214597-68214619 CCGGCTGTATAATTGTTTTAAGG + Intergenic
1027003457 7:74671679-74671701 CCGGCTGTGAAATTTTTCTAGGG - Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1029973209 7:104809684-104809706 ATGGCTTAAAAAGTTTATTATGG + Intronic
1031131647 7:117839831-117839853 CCTACTTTAAAACTATTTTAGGG - Intronic
1034186377 7:149180449-149180471 CTGACTTTAAAAGATTATTAAGG + Exonic
1035167499 7:157000256-157000278 CCGGCTTTAGGAGTTTTATTAGG + Intronic
1035725214 8:1820365-1820387 CTGGCTGTAAAAGTCTTTTAAGG + Intergenic
1035937389 8:3856717-3856739 CAGGCTTTGAAAGATTTTTGAGG - Intronic
1036399223 8:8393447-8393469 CCCCCTTTATTAGTTTTTTAGGG - Intergenic
1037277629 8:17198592-17198614 CTGGTTTTAAAAGTATTTCATGG - Intronic
1043401590 8:79890603-79890625 CTGGCTTTAATAGTTTTTAAGGG + Intergenic
1047152803 8:122283802-122283824 CCGGCTTTTATATTTTTTTGTGG + Intergenic
1048559555 8:135518878-135518900 CAGGATATAAAATTTTTTTAAGG - Intronic
1051162017 9:14219589-14219611 CCTGCTTTACACGTATTTTATGG + Intronic
1055352573 9:75404266-75404288 CTGGCTCTAAAAGTTCTTTAAGG + Intergenic
1055732755 9:79295716-79295738 CCGGCTCTAGAAATTTTATAGGG - Intergenic
1057576987 9:96250584-96250606 CCGCATTTAACAGTTTTTGAAGG - Intronic
1057603852 9:96484083-96484105 ACTGCTTTAAAACTTGTTTATGG + Intronic
1058565425 9:106279291-106279313 CCCCCTTTAAAATTTTTTAAGGG - Intergenic
1203415271 Un_KI270582v1:807-829 CCGGCTTAAGGAGTCTTTTAGGG + Intergenic
1187767822 X:22662492-22662514 CTGGCTTTTAAAATGTTTTAGGG + Intergenic
1191245087 X:58222151-58222173 CTGTCTGTAAAAGTTTTTTGGGG + Intergenic
1191741909 X:64445327-64445349 TCTGCTTTTAAACTTTTTTATGG + Intergenic
1193559334 X:82998207-82998229 TCTGTTTTAAAAGTTCTTTAAGG + Intergenic
1193816048 X:86106438-86106460 CAGTCTTGAGAAGTTTTTTATGG - Intergenic
1195250238 X:103037003-103037025 CCAGGTTTAAAAGTTTTTTGGGG + Intergenic
1196180381 X:112683356-112683378 CCTGCTTTAACAGCTTTTGAGGG + Intergenic
1196287196 X:113896854-113896876 TCTTCTTTAAAAGTTTTTTTTGG + Intergenic
1197564682 X:128067612-128067634 CAGGCTTTACAATTTTTTTAGGG + Intergenic
1197689995 X:129488752-129488774 AAGGCTTTAAAACTTTTTTTTGG - Intronic
1198027447 X:132721191-132721213 CAGGCTTTTAAAATGTTTTATGG - Intronic
1200396005 X:155988317-155988339 TCAGCTTTAAATGTTTATTAAGG - Intergenic
1201013913 Y:9578523-9578545 CCTGCTTTAAAAGTTATATTTGG + Intergenic