ID: 1153636483

View in Genome Browser
Species Human (GRCh38)
Location 18:7117607-7117629
Sequence TCCCCCGCAGGCGGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 2, 2: 5, 3: 22, 4: 291}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153636483_1153636496 2 Left 1153636483 18:7117607-7117629 CCCGCCCGCCCGCCTGCGGGGGA 0: 1
1: 2
2: 5
3: 22
4: 291
Right 1153636496 18:7117632-7117654 GGGACCCTAGGACCCGGGCCGGG 0: 1
1: 0
2: 1
3: 23
4: 217
1153636483_1153636493 -4 Left 1153636483 18:7117607-7117629 CCCGCCCGCCCGCCTGCGGGGGA 0: 1
1: 2
2: 5
3: 22
4: 291
Right 1153636493 18:7117626-7117648 GGGACAGGGACCCTAGGACCCGG 0: 1
1: 0
2: 0
3: 25
4: 281
1153636483_1153636494 -3 Left 1153636483 18:7117607-7117629 CCCGCCCGCCCGCCTGCGGGGGA 0: 1
1: 2
2: 5
3: 22
4: 291
Right 1153636494 18:7117627-7117649 GGACAGGGACCCTAGGACCCGGG 0: 1
1: 0
2: 4
3: 25
4: 237
1153636483_1153636495 1 Left 1153636483 18:7117607-7117629 CCCGCCCGCCCGCCTGCGGGGGA 0: 1
1: 2
2: 5
3: 22
4: 291
Right 1153636495 18:7117631-7117653 AGGGACCCTAGGACCCGGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 157
1153636483_1153636501 18 Left 1153636483 18:7117607-7117629 CCCGCCCGCCCGCCTGCGGGGGA 0: 1
1: 2
2: 5
3: 22
4: 291
Right 1153636501 18:7117648-7117670 GGCCGGGCTCACCTCTCTGCCGG 0: 1
1: 0
2: 0
3: 23
4: 178
1153636483_1153636503 28 Left 1153636483 18:7117607-7117629 CCCGCCCGCCCGCCTGCGGGGGA 0: 1
1: 2
2: 5
3: 22
4: 291
Right 1153636503 18:7117658-7117680 ACCTCTCTGCCGGCACTGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1153636483_1153636492 -10 Left 1153636483 18:7117607-7117629 CCCGCCCGCCCGCCTGCGGGGGA 0: 1
1: 2
2: 5
3: 22
4: 291
Right 1153636492 18:7117620-7117642 CTGCGGGGGACAGGGACCCTAGG 0: 1
1: 0
2: 1
3: 26
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153636483 Original CRISPR TCCCCCGCAGGCGGGCGGGC GGG (reversed) Intronic