ID: 1153637654

View in Genome Browser
Species Human (GRCh38)
Location 18:7127116-7127138
Sequence AGCAGAGTAAGTGAGACAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153637654_1153637658 8 Left 1153637654 18:7127116-7127138 CCGATTGTCTCACTTACTCTGCT No data
Right 1153637658 18:7127147-7127169 CAACTCCACCATGGTGCAGGTGG No data
1153637654_1153637655 -1 Left 1153637654 18:7127116-7127138 CCGATTGTCTCACTTACTCTGCT No data
Right 1153637655 18:7127138-7127160 TTAAATCTCCAACTCCACCATGG No data
1153637654_1153637656 5 Left 1153637654 18:7127116-7127138 CCGATTGTCTCACTTACTCTGCT No data
Right 1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG No data
1153637654_1153637660 14 Left 1153637654 18:7127116-7127138 CCGATTGTCTCACTTACTCTGCT No data
Right 1153637660 18:7127153-7127175 CACCATGGTGCAGGTGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153637654 Original CRISPR AGCAGAGTAAGTGAGACAAT CGG (reversed) Intergenic
No off target data available for this crispr