ID: 1153637658

View in Genome Browser
Species Human (GRCh38)
Location 18:7127147-7127169
Sequence CAACTCCACCATGGTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153637654_1153637658 8 Left 1153637654 18:7127116-7127138 CCGATTGTCTCACTTACTCTGCT No data
Right 1153637658 18:7127147-7127169 CAACTCCACCATGGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153637658 Original CRISPR CAACTCCACCATGGTGCAGG TGG Intergenic
No off target data available for this crispr