ID: 1153652134

View in Genome Browser
Species Human (GRCh38)
Location 18:7250188-7250210
Sequence GTGAGCTGGATTGAATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153652134_1153652138 4 Left 1153652134 18:7250188-7250210 CCTGCAGATTCAATCCAGCTCAC No data
Right 1153652138 18:7250215-7250237 CAGTGTAAATAAAGTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153652134 Original CRISPR GTGAGCTGGATTGAATCTGC AGG (reversed) Intergenic
No off target data available for this crispr