ID: 1153656400

View in Genome Browser
Species Human (GRCh38)
Location 18:7286611-7286633
Sequence CTGACTCCAATCCCTGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153656400_1153656402 6 Left 1153656400 18:7286611-7286633 CCAAGAACAGGGATTGGAGTCAG No data
Right 1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG No data
1153656400_1153656405 20 Left 1153656400 18:7286611-7286633 CCAAGAACAGGGATTGGAGTCAG No data
Right 1153656405 18:7286654-7286676 GTCTGAAGGCCCTGAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153656400 Original CRISPR CTGACTCCAATCCCTGTTCT TGG (reversed) Intergenic
No off target data available for this crispr