ID: 1153656402

View in Genome Browser
Species Human (GRCh38)
Location 18:7286640-7286662
Sequence TTGTAAGTCCCAGAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153656400_1153656402 6 Left 1153656400 18:7286611-7286633 CCAAGAACAGGGATTGGAGTCAG No data
Right 1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG No data
1153656397_1153656402 14 Left 1153656397 18:7286603-7286625 CCAAAGGCCCAAGAACAGGGATT No data
Right 1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG No data
1153656399_1153656402 7 Left 1153656399 18:7286610-7286632 CCCAAGAACAGGGATTGGAGTCA No data
Right 1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153656402 Original CRISPR TTGTAAGTCCCAGAGTCTGA AGG Intergenic
No off target data available for this crispr