ID: 1153656521

View in Genome Browser
Species Human (GRCh38)
Location 18:7287643-7287665
Sequence CAGGCTTAAGGGTCTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153656521_1153656529 3 Left 1153656521 18:7287643-7287665 CCTCCTCCAGACCCTTAAGCCTG No data
Right 1153656529 18:7287669-7287691 CTGATGGTTCTTGCCTCAGCTGG No data
1153656521_1153656530 6 Left 1153656521 18:7287643-7287665 CCTCCTCCAGACCCTTAAGCCTG No data
Right 1153656530 18:7287672-7287694 ATGGTTCTTGCCTCAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153656521 Original CRISPR CAGGCTTAAGGGTCTGGAGG AGG (reversed) Intergenic
No off target data available for this crispr