ID: 1153658041

View in Genome Browser
Species Human (GRCh38)
Location 18:7302747-7302769
Sequence CTGTTCACAGAGATGGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153658039_1153658041 -10 Left 1153658039 18:7302734-7302756 CCTAGAGGTAGAACTGTTCACAG No data
Right 1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153658041 Original CRISPR CTGTTCACAGAGATGGAACT CGG Intergenic
No off target data available for this crispr