ID: 1153659990

View in Genome Browser
Species Human (GRCh38)
Location 18:7317771-7317793
Sequence GCCTAGGGATGCTGCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153659990_1153660003 12 Left 1153659990 18:7317771-7317793 CCCCAGCAGCAGCATCCCTAGGC No data
Right 1153660003 18:7317806-7317828 CTTGAATAAGCTACCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153659990 Original CRISPR GCCTAGGGATGCTGCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr