ID: 1153660061

View in Genome Browser
Species Human (GRCh38)
Location 18:7318098-7318120
Sequence CTGTGGGCCTGGGAGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153660061_1153660067 2 Left 1153660061 18:7318098-7318120 CCTTCTGTCTCCCAGGCCCACAG No data
Right 1153660067 18:7318123-7318145 GCCTGGATGTGAGTTCCCTGTGG No data
1153660061_1153660069 8 Left 1153660061 18:7318098-7318120 CCTTCTGTCTCCCAGGCCCACAG No data
Right 1153660069 18:7318129-7318151 ATGTGAGTTCCCTGTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153660061 Original CRISPR CTGTGGGCCTGGGAGACAGA AGG (reversed) Intergenic
No off target data available for this crispr