ID: 1153660670

View in Genome Browser
Species Human (GRCh38)
Location 18:7323065-7323087
Sequence CAGACCACGAAGTAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153660670_1153660672 2 Left 1153660670 18:7323065-7323087 CCAGCTGCCTACTTCGTGGTCTG No data
Right 1153660672 18:7323090-7323112 TTACAGATTTTCCATTTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153660670 Original CRISPR CAGACCACGAAGTAGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr