ID: 1153660943

View in Genome Browser
Species Human (GRCh38)
Location 18:7325732-7325754
Sequence CTGAGGGAACAGAAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153660936_1153660943 13 Left 1153660936 18:7325696-7325718 CCAGCCAAGAAGATACCAAAGGA No data
Right 1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG No data
1153660939_1153660943 -2 Left 1153660939 18:7325711-7325733 CCAAAGGAAAAGTGTACTAGGCT No data
Right 1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG No data
1153660937_1153660943 9 Left 1153660937 18:7325700-7325722 CCAAGAAGATACCAAAGGAAAAG No data
Right 1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153660943 Original CRISPR CTGAGGGAACAGAAGGTGCA AGG Intergenic
No off target data available for this crispr