ID: 1153664815

View in Genome Browser
Species Human (GRCh38)
Location 18:7359439-7359461
Sequence GAGCAGTTATAGGTGACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153664815_1153664818 -3 Left 1153664815 18:7359439-7359461 CCTTGAGTCACCTATAACTGCTC No data
Right 1153664818 18:7359459-7359481 CTCAAATTTGAGACTTCTGTGGG No data
1153664815_1153664817 -4 Left 1153664815 18:7359439-7359461 CCTTGAGTCACCTATAACTGCTC No data
Right 1153664817 18:7359458-7359480 GCTCAAATTTGAGACTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153664815 Original CRISPR GAGCAGTTATAGGTGACTCA AGG (reversed) Intergenic
No off target data available for this crispr