ID: 1153683734

View in Genome Browser
Species Human (GRCh38)
Location 18:7525275-7525297
Sequence CAAAGCTATGACAATTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153683734_1153683742 18 Left 1153683734 18:7525275-7525297 CCTCCTGAATTGTCATAGCTTTG No data
Right 1153683742 18:7525316-7525338 TGGACAGTGATTAGTGTGAGAGG No data
1153683734_1153683739 -6 Left 1153683734 18:7525275-7525297 CCTCCTGAATTGTCATAGCTTTG No data
Right 1153683739 18:7525292-7525314 GCTTTGGATTTCCTGTTTTGGGG No data
1153683734_1153683740 -2 Left 1153683734 18:7525275-7525297 CCTCCTGAATTGTCATAGCTTTG No data
Right 1153683740 18:7525296-7525318 TGGATTTCCTGTTTTGGGGTTGG No data
1153683734_1153683738 -7 Left 1153683734 18:7525275-7525297 CCTCCTGAATTGTCATAGCTTTG No data
Right 1153683738 18:7525291-7525313 AGCTTTGGATTTCCTGTTTTGGG No data
1153683734_1153683737 -8 Left 1153683734 18:7525275-7525297 CCTCCTGAATTGTCATAGCTTTG No data
Right 1153683737 18:7525290-7525312 TAGCTTTGGATTTCCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153683734 Original CRISPR CAAAGCTATGACAATTCAGG AGG (reversed) Intergenic
No off target data available for this crispr