ID: 1153686411

View in Genome Browser
Species Human (GRCh38)
Location 18:7550535-7550557
Sequence ACCTTGAGTGCTTAGAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153686408_1153686411 1 Left 1153686408 18:7550511-7550533 CCACTGTTCATTTGTAGATTCAG No data
Right 1153686411 18:7550535-7550557 ACCTTGAGTGCTTAGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153686411 Original CRISPR ACCTTGAGTGCTTAGAAATG GGG Intergenic
No off target data available for this crispr