ID: 1153688090

View in Genome Browser
Species Human (GRCh38)
Location 18:7566839-7566861
Sequence CTGCGCTGCTCGGCGGCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153688090_1153688096 -8 Left 1153688090 18:7566839-7566861 CCCGCAGCCGCCGAGCAGCGCAG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 1153688096 18:7566854-7566876 CAGCGCAGGCCCGGCGACTCCGG 0: 1
1: 0
2: 0
3: 9
4: 105
1153688090_1153688097 -7 Left 1153688090 18:7566839-7566861 CCCGCAGCCGCCGAGCAGCGCAG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 1153688097 18:7566855-7566877 AGCGCAGGCCCGGCGACTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 95
1153688090_1153688100 2 Left 1153688090 18:7566839-7566861 CCCGCAGCCGCCGAGCAGCGCAG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 1153688100 18:7566864-7566886 CCGGCGACTCCGGGTGCAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 85
1153688090_1153688105 28 Left 1153688090 18:7566839-7566861 CCCGCAGCCGCCGAGCAGCGCAG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 1153688105 18:7566890-7566912 TGTGCGGTGACATCGCCGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 18
1153688090_1153688102 12 Left 1153688090 18:7566839-7566861 CCCGCAGCCGCCGAGCAGCGCAG 0: 1
1: 0
2: 1
3: 22
4: 181
Right 1153688102 18:7566874-7566896 CGGGTGCAGCTGGCCCTGTGCGG 0: 1
1: 0
2: 0
3: 20
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153688090 Original CRISPR CTGCGCTGCTCGGCGGCTGC GGG (reversed) Exonic
900342978 1:2197396-2197418 CTGCGCTGCCCGGCTGGCGCAGG + Intronic
900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG + Intergenic
901057468 1:6455364-6455386 CTGCCCCGCGTGGCGGCTGCCGG + Intronic
901243065 1:7705707-7705729 CTGCGCTCCTCAGCGGGTGCGGG + Intronic
901336050 1:8450345-8450367 CTGTGCTTCTCGGTGGCTGTTGG - Intronic
902597739 1:17520680-17520702 CTGCCCTGCTAGGTGGCTGTAGG - Intergenic
905584465 1:39105778-39105800 CCGGTCGGCTCGGCGGCTGCAGG + Intronic
906263147 1:44407853-44407875 CGGGGCTGCTCGGGGGCTGGAGG + Intronic
906522290 1:46474746-46474768 CTGCGCCTCTCTGCGGCTCCGGG - Intergenic
907274676 1:53310613-53310635 CTGCGCTGCTCTGAGGACGCAGG + Intronic
910246385 1:85143046-85143068 CTGCTCTGCTCTGCGTCAGCTGG - Intergenic
912691208 1:111805783-111805805 CTGCCCTGCTCTGCAGCCGCGGG - Intronic
915616878 1:157045909-157045931 CTGCGCTGCCCGCCGCCCGCCGG + Intergenic
915698492 1:157768605-157768627 CTGCTCTGCTCAGTGGCTGGGGG - Exonic
918045085 1:180936558-180936580 CAGCGCACCTCGGGGGCTGCAGG + Exonic
918050604 1:180969534-180969556 CTGCGCTGCTGGGTGGCAGCTGG + Intergenic
918061155 1:181062393-181062415 CTGAGCTGCTGGGTGGCAGCTGG + Intergenic
922044182 1:221927832-221927854 CTGCACTGTGCAGCGGCTGCTGG - Intergenic
922677358 1:227561066-227561088 CTGAGCTGCTCGCCGGCGGCCGG - Intergenic
923055925 1:230426007-230426029 CTGCGCTGGTGGGGGGCGGCGGG - Intergenic
1067561931 10:47310333-47310355 CTGCGCGGCTCGGCGCACGCGGG - Exonic
1069624482 10:69859463-69859485 GTGCCCTGCCCGGCGACTGCCGG - Intronic
1070777562 10:79118688-79118710 CGGGGCTGCTCGGCCGGTGCTGG + Intronic
1073105708 10:101031151-101031173 CCACGCTGCGCGGAGGCTGCGGG + Intronic
1073425028 10:103451149-103451171 CGGAGCTGCTGGGAGGCTGCTGG - Exonic
1074687902 10:115976702-115976724 CAGAGCTGCTGGGAGGCTGCTGG - Intergenic
1078354394 11:10623368-10623390 CTGCCCTGCTGGGTAGCTGCAGG - Intronic
1081914106 11:46719869-46719891 CTGGGCTGCTCGGACGGTGCCGG + Intronic
1083768310 11:64852901-64852923 CAGCGCTGCTCGGAGTCTGCAGG - Exonic
1083891870 11:65599598-65599620 CTGGGCCTCCCGGCGGCTGCAGG + Exonic
1083920984 11:65781266-65781288 CTGCGCGGCTTGGCGGGCGCTGG - Intergenic
1091813922 12:3421914-3421936 CTGCGCTGCTGGCCTGCTACTGG + Intronic
1092132602 12:6123231-6123253 CTGCCCAGGTAGGCGGCTGCTGG + Intronic
1097938660 12:65279428-65279450 CTGCGCTGCTGCCCCGCTGCTGG + Intronic
1098856539 12:75659047-75659069 CTAGGCTGCTCGGAGCCTGCAGG + Intergenic
1102207180 12:111098667-111098689 CTGAGCTGCTCTGGGGCTGGGGG - Intronic
1102884070 12:116508511-116508533 CTGCGCTGCTCGGCCCCAGCGGG + Intergenic
1105413851 13:20192852-20192874 CTGCGCTCCTAGGCGGGTCCTGG + Intronic
1107364540 13:39656017-39656039 CTCCGCTGCTCTGCGGGCGCCGG + Intronic
1107686543 13:42906112-42906134 CTGCTCTGCTGGGGAGCTGCAGG + Intronic
1112508929 13:99991517-99991539 CTGGGCTGCTCCGCGGAGGCCGG + Intergenic
1112692787 13:101916258-101916280 CTGCACTTCTCGGCGGCTACAGG + Intronic
1113104825 13:106760490-106760512 CTCTGCGGCTAGGCGGCTGCCGG + Intergenic
1115306854 14:31942626-31942648 CTGAGTGGCTCGGCGGCTGAAGG + Intergenic
1115724110 14:36194421-36194443 CCCAGCTGCTCTGCGGCTGCTGG + Intergenic
1117065288 14:52007809-52007831 CTGCTCTGCTGGGCAGATGCAGG - Exonic
1117634761 14:57730060-57730082 CTGCACTGCATGGTGGCTGCTGG + Intronic
1118317944 14:64737146-64737168 CTGCGCTGCTCTGTGGCCCCTGG + Intronic
1119563352 14:75608331-75608353 CTGAGCTGTTCGGCGGCTCCAGG + Intronic
1122418403 14:101561075-101561097 CGGCGCGGCTCGGCGGCCGCCGG + Intergenic
1122711598 14:103662703-103662725 CTGCACTGCTGTGCTGCTGCTGG - Exonic
1123505561 15:20939667-20939689 CTGCACTGCACGGCTGTTGCGGG - Intergenic
1123562798 15:21513375-21513397 CTGCACTGCACGGCTGTTGCGGG - Intergenic
1123599043 15:21950658-21950680 CTGCACTGCACGGCTGTTGCGGG - Intergenic
1125606316 15:40941770-40941792 CTGCGGGGCACGGCGGCGGCAGG - Intergenic
1128842812 15:70863946-70863968 CTGTGCTGCTCATCAGCTGCAGG + Intronic
1202971150 15_KI270727v1_random:240508-240530 CTGCACTGCACGGCTGTTGCGGG - Intergenic
1132466161 16:78238-78260 CTTCCGTGGTCGGCGGCTGCTGG + Exonic
1132568308 16:633208-633230 CAACGCTGCTGGGCTGCTGCGGG + Exonic
1132672466 16:1107480-1107502 CTGCGGGGCTCTGTGGCTGCAGG - Intergenic
1132870769 16:2114822-2114844 CTGCACTGCTCGCCGGCTCCCGG - Exonic
1134521761 16:14922082-14922104 CCGCACTGCTCGCCGGCTCCCGG + Intronic
1134709431 16:16320733-16320755 CCGCACTGCTCGCCGGCTCCCGG + Intergenic
1134716644 16:16360762-16360784 CCGCACTGCTCGCCGGCTCCCGG + Intergenic
1134950172 16:18347912-18347934 CTGCACTGCTCGCCGGCTCCCGG - Intergenic
1134958106 16:18391397-18391419 CCGCACTGCTCGCCGGCTCCCGG - Intergenic
1135057877 16:19245460-19245482 CTGCCCTTCTCGGCGCCTGGTGG - Intronic
1135218415 16:20592456-20592478 CTGGGCTGCTGGGCTGCTGGAGG - Intergenic
1136153111 16:28365030-28365052 CTGGGCTCCTCGGCTGCTGCGGG - Intergenic
1136209974 16:28750243-28750265 CTGGGCTCCTCGGCTGCTGCGGG + Intergenic
1136500194 16:30666277-30666299 CTGCCCTGCTGGAAGGCTGCGGG - Intronic
1139650748 16:68361039-68361061 CTGCGCTGCTCTGCGCCTCTGGG - Exonic
1142190786 16:88716395-88716417 CAGCACTGCACGGCGGCAGCTGG - Exonic
1142810383 17:2393190-2393212 CTCCGCGTCTCCGCGGCTGCCGG + Intronic
1142851068 17:2704989-2705011 CTGGGCTGCAGGGGGGCTGCAGG + Intronic
1146151573 17:30477561-30477583 CTGCTCAGCTCGGCCGCTCCGGG - Intronic
1146329686 17:31917216-31917238 CTGCCCTGCCCGGCGGCGGCCGG + Intergenic
1146912526 17:36657900-36657922 CGCGGCTGCTCGGCGGCGGCCGG + Intergenic
1146913222 17:36661276-36661298 CTGCGATGCTCACCGGCTGGAGG + Intergenic
1146922055 17:36720326-36720348 CTGCGCTGCTTGGCAGCAGATGG + Intergenic
1147668914 17:42165553-42165575 CTCGGCTGCTCAGCTGCTGCAGG + Exonic
1148552725 17:48560144-48560166 CTGGGCAGCTTGGGGGCTGCAGG + Intronic
1148838874 17:50482138-50482160 CTGCGATGCTCTGCGGACGCTGG + Exonic
1150084761 17:62267922-62267944 TTGCGCTGCTCTGCGGGAGCTGG + Intergenic
1150168442 17:62966493-62966515 CGGCTCGGCTCGGCGGCGGCGGG - Intergenic
1151763801 17:76121998-76122020 CTGCGCTGGGCAGCGGGTGCGGG + Intergenic
1152123855 17:78434848-78434870 CTGCTCTACTCAGCGGCTGACGG + Intronic
1153654848 18:7273343-7273365 CAGAGCTGCTCAGCTGCTGCCGG + Intergenic
1153688090 18:7566839-7566861 CTGCGCTGCTCGGCGGCTGCGGG - Exonic
1159586900 18:70289724-70289746 CGGGGCTGCTCTGCGGCTGAAGG + Intronic
1160239215 18:77111195-77111217 CTGGGCTCCTCGGTGGATGCTGG - Intronic
1160479350 18:79224638-79224660 CTGCCCTGCTAGCTGGCTGCTGG - Intronic
1160981284 19:1817732-1817754 ATGTGCTGCTCGGCTGCCGCCGG - Exonic
1161326815 19:3668062-3668084 CTGCGCTGACCGGAGGCTGCGGG - Intronic
1161525512 19:4752542-4752564 CAGCTCTGCTCAGCTGCTGCCGG - Intergenic
1164578115 19:29417886-29417908 CTGTGCTGGTCAGCGGCTGGAGG - Intergenic
1164635380 19:29787680-29787702 CTGGGCTGCTCCAGGGCTGCGGG - Intergenic
1165080178 19:33302327-33302349 CGGCGCTGCTGGGCGCGTGCGGG + Exonic
1165879505 19:39032286-39032308 CTGCGCGCCGCGGAGGCTGCTGG - Intronic
1166705484 19:44905832-44905854 CTGCGCTTCTCACCGGCTCCTGG - Exonic
1168154553 19:54465455-54465477 CCGCGCCGCTCGGCGACTTCCGG - Exonic
1168340759 19:55621836-55621858 CTGGGCTCGTCGGCGGCTGAGGG - Exonic
924995283 2:355280-355302 CTGCGCTGATCGTGGGGTGCGGG + Intergenic
926155384 2:10450543-10450565 GAGCTCTGCTCTGCGGCTGCAGG + Intergenic
926606702 2:14905455-14905477 CTGTCCCGCTCGGTGGCTGCGGG + Intergenic
927484158 2:23477528-23477550 CTGGGCTGCTGGGAGGCTGAAGG - Intronic
927980229 2:27370362-27370384 CTGCCTCGCTCCGCGGCTGCAGG + Intronic
928606323 2:32947511-32947533 AGCCGCAGCTCGGCGGCTGCCGG + Exonic
932580511 2:72990136-72990158 CTGCGCTGCCCCGGGGCTGGCGG - Intronic
932599357 2:73113058-73113080 CCGGGCTGGTCTGCGGCTGCCGG - Intronic
932892478 2:75609036-75609058 CTGCGCTGCCCTGGGGCTCCTGG + Intergenic
934638177 2:96009934-96009956 CTGCTCAGCTCTTCGGCTGCCGG - Intergenic
934840183 2:97619632-97619654 CTGCACAGCTGGGCGGCAGCGGG - Intergenic
935790010 2:106582255-106582277 CTGCGCTGCTCGCGGCCGGCAGG + Intergenic
937930196 2:127198922-127198944 CTGCACTGCTGGGGGGCTCCAGG - Intronic
938293251 2:130161470-130161492 CTGCGCTGGCCCGCGGCTGCTGG - Intronic
938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG + Intergenic
938728773 2:134130069-134130091 CGGCGCTCCTCCGCAGCTGCTGG - Intronic
942046557 2:172102439-172102461 CGCCGCCGCTCGGGGGCTGCTGG + Exonic
944221850 2:197310914-197310936 CTGCGCGGCTCGGCTGCGGGCGG - Intronic
946865643 2:224039249-224039271 CCGGGCTGCGCGGCGTCTGCAGG - Intronic
947874829 2:233461188-233461210 CTGTGCTGCTCCGCCGGTGCGGG + Intronic
948844933 2:240678517-240678539 CAGCTCTCCTCGGAGGCTGCTGG - Intronic
948848927 2:240696362-240696384 CAGCTCTCCTCGGAGGCTGCTGG + Intronic
948963214 2:241356257-241356279 GCGCGCTGCGCGGGGGCTGCCGG + Exonic
1168887006 20:1266794-1266816 CTGCGCTGCACCGCGGCAGGTGG + Intronic
1173741596 20:45406114-45406136 CTGCCCTGCTGGGCGGCACCGGG + Intronic
1176171769 20:63699422-63699444 CTGGGCTGCTCAGGGGCTGGTGG - Exonic
1179675066 21:42975185-42975207 CGGGGCTGCTCGGAGGGTGCGGG + Intronic
1181064391 22:20298858-20298880 CTGCGCTGATCGGCGGGCTCCGG + Intergenic
1181570937 22:23767578-23767600 GGGCGCGGCTGGGCGGCTGCGGG + Exonic
1182508588 22:30802972-30802994 GTGTGCTGCCCGGCGGCTCCGGG - Intronic
1183577513 22:38701169-38701191 CTGCGCACCTCGGCGGCGGCCGG + Intronic
1183770424 22:39920493-39920515 CTGAGCTGCACCCCGGCTGCAGG - Intronic
1184976473 22:48065972-48065994 CTCCGCTGCCCGGTGGCTCCTGG + Intergenic
950966685 3:17151675-17151697 CTGAGCTGCTCTGGGGCTGGAGG - Intergenic
952316663 3:32238377-32238399 CTGGGCGGGTCGGGGGCTGCGGG - Intergenic
952447498 3:33396225-33396247 CTGTGCTGCTTGGCTGCTCCCGG + Exonic
954117128 3:48473207-48473229 CTTGGCTGCTAGCCGGCTGCTGG - Intronic
956115239 3:65911398-65911420 CTGGGCAGCTCTGGGGCTGCTGG - Intronic
956813581 3:72888166-72888188 CTGCGCATCGCGGCGGCGGCAGG - Exonic
958026833 3:88059027-88059049 CAATGCTGCTCGGCGGTTGCTGG - Intronic
960756414 3:121018982-121019004 CAGCCCTGCTCACCGGCTGCCGG + Intronic
966849421 3:184155516-184155538 CAACCCAGCTCGGCGGCTGCTGG - Exonic
968655295 4:1775960-1775982 CAGCGCTGCTCGGCTGCCCCGGG + Intergenic
968658362 4:1788338-1788360 CTGAGCTGCTCAGCGGCTACCGG + Intergenic
969509758 4:7611063-7611085 CTGGGCTGCATGGTGGCTGCAGG - Intronic
973844308 4:54894899-54894921 CTACTCTGCTCTGTGGCTGCTGG + Intergenic
974429414 4:61776237-61776259 CTGCACGACTCGGCGGCAGCAGG + Intronic
976281988 4:83334807-83334829 CTCCGCTGCGCGGCAGCTGGCGG - Exonic
985208034 4:187561607-187561629 CTGCTCTGCTGGGCGGCTGGGGG + Intergenic
985248170 4:187997053-187997075 CGGCGCTCCCCGGGGGCTGCAGG - Intronic
985532502 5:442517-442539 CTGCGCTGCTGGGCCTCTGAGGG + Exonic
986480602 5:8183170-8183192 CTAGGCTGCTCGGGGGCTGGTGG + Intergenic
988577727 5:32443912-32443934 CGGCTCCGCTCGGCGGCCGCAGG + Intronic
992716236 5:79513988-79514010 CTGCTCTGCCCGGCGGTAGCCGG - Exonic
994107248 5:95961437-95961459 CTGCCCTGCCTGGCCGCTGCGGG + Intronic
1001949902 5:175809014-175809036 CTGCTCTGCTCAGCGACTGAAGG + Exonic
1002222262 5:177693015-177693037 CTGCGCTGTCCAGTGGCTGCAGG - Intergenic
1002487642 5:179550590-179550612 CTGCGCTGCTGGGCGGGGGCGGG + Exonic
1005098716 6:22146536-22146558 CAGCGCAGCTCGGCGCCAGCGGG - Intergenic
1006084526 6:31586768-31586790 CCGCGCTGCTCTGCGGCTCAGGG + Intronic
1007363549 6:41374624-41374646 CTGCGCAGCTCTTCTGCTGCCGG + Intergenic
1010676544 6:78752860-78752882 CTGTGCTGCATGGCTGCTGCTGG - Intergenic
1011734319 6:90296548-90296570 CTGCCCACCTCGCCGGCTGCCGG - Exonic
1015403723 6:132814576-132814598 CCGCGCGACTCGGCGGCGGCAGG - Exonic
1015910171 6:138161840-138161862 CTCCGCTCGGCGGCGGCTGCGGG - Intergenic
1016356748 6:143226901-143226923 CTGGGCTGCATGTCGGCTGCGGG - Intronic
1017774614 6:157671038-157671060 CTGCACCGCTCTGTGGCTGCAGG + Intronic
1018849794 6:167578643-167578665 CTGGGCTGCGTGGTGGCTGCAGG - Intergenic
1019417944 7:935752-935774 CTGCTCTGCCCCGCGGGTGCCGG + Intronic
1019487764 7:1297133-1297155 GTGCCCAGCACGGCGGCTGCAGG - Intergenic
1020023603 7:4883521-4883543 GGGCGCTGCTCGGCCGCTGCCGG - Intronic
1022020883 7:26398548-26398570 CGGCCCGGCTCGGCGGCTGGGGG + Intergenic
1024074820 7:45812990-45813012 CTGGGCTGCACGCGGGCTGCCGG - Intergenic
1024636250 7:51292794-51292816 CAGGGCTGCTCGGGGCCTGCAGG - Intronic
1024946537 7:54813531-54813553 CTGCCCTGCTGGGCGCCTTCGGG + Intergenic
1025176434 7:56804564-56804586 CTGGGCCGCTCGCGGGCTGCCGG - Intergenic
1025695354 7:63771822-63771844 CTGGGCCGCTCGCCGACTGCCGG + Intergenic
1029206199 7:98870421-98870443 CTGCGCTGCAAGCCGCCTGCAGG + Intronic
1029305557 7:99617091-99617113 CTACGGGGCTCGGCGGCAGCGGG + Intronic
1029610151 7:101622459-101622481 CTGAGGTGCACGGGGGCTGCAGG + Intronic
1034978884 7:155463336-155463358 CTGCGGGCCTGGGCGGCTGCTGG - Exonic
1036428177 8:8665737-8665759 CTGCACTGCTTGGCTTCTGCTGG - Intergenic
1036662289 8:10716145-10716167 CTGGGCTGCTGGGCCCCTGCCGG + Intergenic
1049095306 8:140545001-140545023 CAGCCTTGCTCGGCTGCTGCAGG + Intronic
1049593491 8:143472976-143472998 CTGCCCTGCTCTGCGGAAGCTGG - Intronic
1049806896 8:144545170-144545192 CTGCTGTGCTGGGCGGCAGCTGG - Intronic
1051191315 9:14516082-14516104 CTGGGCAGCTCGGCTGCTGTGGG - Intergenic
1057315943 9:93968594-93968616 CTGGGCTGGTCTGGGGCTGCAGG - Intergenic
1057442076 9:95090354-95090376 CTGGGCTGCCCGGCTCCTGCGGG - Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1057922078 9:99105446-99105468 CCGCGCGGCTCGGCGGCTGCCGG + Intronic
1059356423 9:113702727-113702749 CTGATCTGCTCGGAGGCTTCCGG - Intergenic
1060074564 9:120579919-120579941 CTGGGACGCTCAGCGGCTGCAGG - Exonic
1060106768 9:120877400-120877422 CTGCGGAGCCCGGCGGCCGCGGG - Intronic
1060474592 9:123977191-123977213 CTCTGCTGCACCGCGGCTGCCGG - Intergenic
1060476770 9:123992932-123992954 CTCTGCTGCACCGCGGCTGCCGG + Intergenic
1060480438 9:124013989-124014011 CCGCGCTGTGCGCCGGCTGCGGG + Exonic
1061378115 9:130238079-130238101 CTGGGCTGCGCTGCTGCTGCGGG + Intergenic
1062402786 9:136379731-136379753 CTGTGCTGCTTGGGGGCTGTGGG + Intronic
1186660565 X:11664688-11664710 CGGCCCTGATCGGCGGCTGCGGG - Exonic
1189484722 X:41421291-41421313 CTGCCCTGCTTGGAGGTTGCAGG - Intergenic
1192839311 X:74837145-74837167 CTGTGCTGCATGGCTGCTGCTGG + Intronic
1195702725 X:107716862-107716884 CTGGGCGGCTGGGTGGCTGCTGG + Intronic