ID: 1153688092

View in Genome Browser
Species Human (GRCh38)
Location 18:7566840-7566862
Sequence CCGCAGCCGCCGAGCAGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153688089_1153688092 -8 Left 1153688089 18:7566825-7566847 CCTGGCTCGCTTTTCCCGCAGCC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG 0: 1
1: 0
2: 3
3: 23
4: 182
1153688086_1153688092 10 Left 1153688086 18:7566807-7566829 CCGGAGCCTCAGCGATCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 263
Right 1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG 0: 1
1: 0
2: 3
3: 23
4: 182
1153688088_1153688092 4 Left 1153688088 18:7566813-7566835 CCTCAGCGATCTCCTGGCTCGCT 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG 0: 1
1: 0
2: 3
3: 23
4: 182
1153688084_1153688092 14 Left 1153688084 18:7566803-7566825 CCCTCCGGAGCCTCAGCGATCTC 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG 0: 1
1: 0
2: 3
3: 23
4: 182
1153688085_1153688092 13 Left 1153688085 18:7566804-7566826 CCTCCGGAGCCTCAGCGATCTCC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG 0: 1
1: 0
2: 3
3: 23
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153688092 Original CRISPR CCGCAGCCGCCGAGCAGCGC AGG Exonic
901243063 1:7705706-7705728 CCGCACCCGCTGAGGAGCGCAGG - Intronic
902817198 1:18923068-18923090 CCAAAGCCGCTGAGCAGGGCAGG + Intronic
904642009 1:31938134-31938156 CCGCCGCCGCCGGGCCGGGCCGG - Exonic
905151455 1:35931098-35931120 CCGCCGCCGCCGACCTGCCCGGG - Exonic
905710363 1:40097164-40097186 CTGCAGCGCCCGAGAAGCGCAGG + Exonic
906292987 1:44632008-44632030 CCGCCGCCGCCGGGCAGCCACGG + Intronic
906522292 1:46474747-46474769 CCGGAGCCGCAGAGAGGCGCAGG + Intergenic
906532865 1:46533421-46533443 CCGCAGGCGCAGCACAGCGCCGG + Intergenic
912086720 1:106015098-106015120 CCGCAGAAGCCAAGCAGAGCTGG - Intergenic
913109255 1:115642506-115642528 CTGCAGCAGCCGTGCAGGGCGGG + Intronic
914265836 1:146037821-146037843 CCGCCGCCGCCCAGCGGAGCGGG + Intergenic
914753145 1:150549300-150549322 CCGGGGCCGCCGAGGGGCGCGGG + Intergenic
914919600 1:151838427-151838449 CCGCACTCGCCGCGCCGCGCCGG - Exonic
915268826 1:154737804-154737826 CCTCAGCCTCCGAGCAGCTGGGG - Intronic
915698494 1:157768606-157768628 CCCCAGCCACTGAGCAGAGCAGG + Exonic
919409140 1:197222195-197222217 CCGCTGCGGCCGCGCAGTGCAGG - Intergenic
919465693 1:197919999-197920021 CCGCAGCCGGCGCACAGGGCGGG - Exonic
922677359 1:227561067-227561089 CGGCCGCCGGCGAGCAGCTCAGG + Intergenic
923573777 1:235140305-235140327 CCGCAAGCGCCGCGCAGCCCTGG - Intronic
923783011 1:237042463-237042485 CCGCCGCCGCCGAGCTCCGCGGG + Exonic
1062937907 10:1401471-1401493 CCGGAGGCCCCGAACAGCGCTGG - Intronic
1064208967 10:13347771-13347793 CCGCCGCCGCCGCGCGGGGCCGG - Intronic
1065188611 10:23191983-23192005 CCGCGCGCGCTGAGCAGCGCCGG - Intergenic
1065188867 10:23192950-23192972 CCGCAGCCGCCGCTCCGCTCAGG - Exonic
1066665696 10:37780775-37780797 CCACTGCCCCCGAGCCGCGCGGG + Intronic
1067561933 10:47310334-47310356 CCGCGTGCGCCGAGCCGCGCAGG + Exonic
1070570648 10:77637748-77637770 CCGCCGCCGCCGCGGAGCGCGGG + Intronic
1073105705 10:101031150-101031172 CCGCAGCCTCCGCGCAGCGTGGG - Intronic
1075645183 10:124092379-124092401 CCGCCACCGCCGGGAAGCGCCGG + Intronic
1077187462 11:1241771-1241793 CCGCAGCCTACGAGTAGCCCGGG + Exonic
1077730336 11:4723160-4723182 TCGCAGATGCCGAGCAGCGTGGG - Intronic
1081867154 11:46366314-46366336 CAGCAGCGGCCCAGCAGCGTGGG + Exonic
1082076613 11:47980461-47980483 CCGCAGCCGCCGGGCCGGCCGGG + Intergenic
1083396782 11:62398109-62398131 CCGCAGGAGCCATGCAGCGCTGG + Intergenic
1083768311 11:64852902-64852924 CTGCAGACTCCGAGCAGCGCTGG + Exonic
1087175301 11:95090190-95090212 CCGGCGGCGCCGAGCAGCGATGG + Exonic
1088889916 11:114036282-114036304 CCGCAGCCAGAGCGCAGCGCCGG - Intergenic
1089993443 11:122882946-122882968 TCGCGGCCGCGGAGGAGCGCCGG + Exonic
1092159950 12:6310695-6310717 CCGCGGGAGCCGGGCAGCGCGGG - Intronic
1094719940 12:33052924-33052946 CCGCCGCCGCCGGGCAGGCCGGG + Intergenic
1096230888 12:49896182-49896204 CCGCAGCCCCCGTACAGGGCTGG + Intronic
1096584449 12:52610791-52610813 TCGCTGACGCCGAGCAGCGGGGG - Exonic
1096589319 12:52646916-52646938 TCGCAGATGCCGAGCAGCGTGGG - Exonic
1102520680 12:113476062-113476084 CCGCCGCCGCCGCGCAGACCCGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104981740 12:132576016-132576038 CCACAGCCGCCTGGCAGCGTGGG + Intronic
1106480479 13:30133612-30133634 CCCCAGCCGCAGGGCCGCGCAGG + Intergenic
1106517162 13:30465389-30465411 CCGCCGCCGCCGAGCCGCGCCGG + Intronic
1107709948 13:43141816-43141838 CCGAAGCAGCAGAGCAGCGGGGG - Intergenic
1111672678 13:91348741-91348763 CCGCTCCCGCCGAGCCGGGCTGG - Intergenic
1116326906 14:43541301-43541323 TCACAGTTGCCGAGCAGCGCAGG - Intergenic
1122418402 14:101561074-101561096 CGGCGGCCGCCGAGCCGCGCCGG - Intergenic
1123041103 14:105490558-105490580 CCGCCGCCACGGAGCAGCCCCGG - Intronic
1124109350 15:26772583-26772605 CCGCATCCGCGGAGCAGCGGCGG - Intronic
1124629094 15:31327032-31327054 TCGCAGACGCGGAGCCGCGCGGG + Exonic
1127151561 15:56080821-56080843 CCTCAGCCGCCGAGTAGCTGGGG + Intergenic
1132055622 15:98648825-98648847 CCGGAGCCCCCGCGCAGAGCAGG + Intergenic
1132870770 16:2114823-2114845 CGGGAGCCGGCGAGCAGTGCAGG + Exonic
1134521759 16:14922081-14922103 CGGGAGCCGGCGAGCAGTGCGGG - Intronic
1134709429 16:16320732-16320754 CGGGAGCCGGCGAGCAGTGCGGG - Intergenic
1134716642 16:16360761-16360783 CGGGAGCCGGCGAGCAGTGCGGG - Intergenic
1134950173 16:18347913-18347935 CGGGAGCCGGCGAGCAGTGCAGG + Intergenic
1134958108 16:18391398-18391420 CGGGAGCCGGCGAGCAGTGCGGG + Intergenic
1135023809 16:18984033-18984055 CGGCAGCCTCTGAGGAGCGCGGG + Exonic
1136153113 16:28365031-28365053 CCGCAGCAGCCGAGGAGCCCAGG + Intergenic
1136209972 16:28750242-28750264 CCGCAGCAGCCGAGGAGCCCAGG - Intergenic
1137758022 16:50918111-50918133 CCGCAGCTGCTCAGCAGCCCCGG + Intergenic
1137988722 16:53131328-53131350 CCCCACCGGCCGAGCAGCGGCGG - Intronic
1138360750 16:56425441-56425463 CCGCCGCCGCCGCGCCGGGCCGG + Exonic
1139468391 16:67165949-67165971 CCGTCGTCGCCGCGCAGCGCGGG - Exonic
1141694505 16:85613288-85613310 CTGCCGCCGCCGAGCAGCCCCGG + Exonic
1142334995 16:89482674-89482696 CCTCAGCCCCCCAGCAGTGCTGG - Intronic
1142345871 16:89553735-89553757 CTGCAGGCGCAGAGCAGTGCTGG - Intronic
1144565123 17:16353395-16353417 CTGCGGCCGCCAAGCTGCGCGGG - Exonic
1145062426 17:19741590-19741612 CCCCAGACCCCGAGCAGCGGTGG + Intronic
1145307064 17:21681247-21681269 TCGCTGCCGCCGCGCAGCGGTGG - Intergenic
1146912525 17:36657899-36657921 CGGCCGCCGCCGAGCAGCCGCGG - Intergenic
1147307407 17:39573640-39573662 CCGCCGCCGCCGGGCCGCGCCGG + Intergenic
1148225291 17:45894825-45894847 CCCCAGCCCCCGAGCAGGGGAGG - Intronic
1148913274 17:50954738-50954760 CCGCAGCCACTGAGCATCCCTGG - Intergenic
1150286527 17:63957513-63957535 CCGCAGCTGCCAAGCAGGGAGGG + Exonic
1150549034 17:66192098-66192120 TCGCCGCCGCCCAGCAGCCCGGG + Intergenic
1151828689 17:76537562-76537584 CCGCCGCCGCCGAGCAAAGCCGG - Exonic
1152563647 17:81090736-81090758 CCGCAGCCTCCCCGCAGCTCGGG - Intronic
1152725138 17:81941432-81941454 CCGCAGCCGTCGCGCATAGCAGG + Exonic
1152924101 17:83079738-83079760 CCGGAGCCGGCGAGCCGGGCGGG - Exonic
1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG + Exonic
1154032762 18:10767737-10767759 CCGCAGCCTTGGAGCAGCTCTGG - Intronic
1155007440 18:21741333-21741355 CCGCCGCCTCCGAGCAGCCGCGG + Exonic
1156099744 18:33578740-33578762 CCGCCGCCGCGGACCGGCGCGGG - Intronic
1157063560 18:44321211-44321233 TCGCAGATGCCGAGCAGCTCGGG - Intergenic
1157609641 18:48948656-48948678 CCGCAGCCGCCGCGCTCGGCTGG + Intronic
1158478862 18:57803332-57803354 CCGCGGCCGCCGAGCCTCGCTGG + Intergenic
1159586899 18:70289723-70289745 CTTCAGCCGCAGAGCAGCCCCGG - Intronic
1159670240 18:71212819-71212841 CCGCAAGCGCCGCGCAGCCCTGG + Intergenic
1160673180 19:375916-375938 CCGCAGCCTCAGAGCTGGGCTGG + Exonic
1161443368 19:4304859-4304881 CCTCAGCCGCAGAGCAGCTGGGG - Intronic
1162609528 19:11738594-11738616 CCGCAGCGGCCGAGCAGGGACGG + Intronic
1162630807 19:11925471-11925493 CCGCAGTCGCCGCGCAGGGACGG - Intronic
1162705329 19:12551111-12551133 CCGCAGTCGCCGCGCAGGGACGG + Intronic
1162713181 19:12611204-12611226 CCGCAGTCGCCGCGCAGGGACGG - Intronic
1164400179 19:27896668-27896690 CTGCAGCCTCAGAGCAGCCCAGG - Intergenic
1164635382 19:29787681-29787703 CCGCAGCCCTGGAGCAGCCCAGG + Intergenic
1165448237 19:35868517-35868539 CCGCCGCCCCCGGGCTGCGCCGG - Exonic
1166533203 19:43554685-43554707 GGGCAGCCGCCGAGAAGCGCTGG - Exonic
1167042742 19:47032285-47032307 CCGCCGCGGCCCCGCAGCGCTGG + Exonic
1168320037 19:55503686-55503708 CCCCAGACGGCGAGCAGGGCGGG - Intronic
1168528374 19:57106408-57106430 CGGCGGCGGCCGAGCTGCGCGGG + Intergenic
925174201 2:1770889-1770911 CGGCAGCCGCCGCTCAGCCCCGG + Intergenic
925984988 2:9207656-9207678 CCGCAGCCCCCGAGCGCCGCAGG + Intronic
927213240 2:20651250-20651272 CCGGAAGCTCCGAGCAGCGCAGG - Intergenic
935820157 2:106886436-106886458 CCGCCGGCGCGGAGCAGCGCTGG - Exonic
938728774 2:134130070-134130092 CAGCAGCTGCGGAGGAGCGCCGG + Intronic
939900323 2:147843906-147843928 CCGCGCCCGCCGAGCTGCCCAGG - Intergenic
942046556 2:172102438-172102460 CAGCAGCCCCCGAGCGGCGGCGG - Exonic
942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG + Intergenic
943064436 2:183071466-183071488 TCGCAGATGCGGAGCAGCGCGGG - Intergenic
946326129 2:218985461-218985483 CCGCAGCCGGGGAGACGCGCGGG + Exonic
946865645 2:224039250-224039272 CTGCAGACGCCGCGCAGCCCGGG + Intronic
948831144 2:240598798-240598820 CCGCAGCCTCCTGGCAGGGCTGG - Exonic
1170150422 20:13221474-13221496 CCGCCGCCGCCAGGCAGCGCCGG + Intergenic
1171013726 20:21522308-21522330 TCGTCGCCGCCGAGCGGCGCCGG - Intergenic
1171573611 20:26276994-26277016 TCGCTGCCGCCGTGCAGCGGTGG + Intergenic
1171806792 20:29688097-29688119 TCGCTGCCGCCAAGCAGCGGTGG + Intergenic
1171892501 20:30728824-30728846 GCGCAGGCGCCTAGCACCGCAGG + Intergenic
1173741594 20:45406113-45406135 CCGGTGCCGCCCAGCAGGGCAGG - Intronic
1176374763 21:6081522-6081544 GCGCAGCCTCCTATCAGCGCTGG - Intergenic
1176426003 21:6548562-6548584 CAGGAGCCGCCGTGCAGCCCAGG - Intergenic
1177905291 21:26966257-26966279 CAGCAGCCGCCCAGCCCCGCCGG - Exonic
1178916406 21:36707873-36707895 CAGGAGCCCCCGGGCAGCGCGGG - Intronic
1179021570 21:37645662-37645684 CCGCAGCCCCAGAGCAGCCTAGG - Intronic
1179701494 21:43156879-43156901 CAGGAGCCGCCGTGCAGCCCAGG - Intergenic
1179748712 21:43456723-43456745 GCGCAGCCTCCTATCAGCGCTGG + Intergenic
1182903958 22:33920761-33920783 CCGCCGCCTCCGAGATGCGCCGG + Intronic
1185313606 22:50169832-50169854 CCGCAGCACCCCAGGAGCGCGGG + Intergenic
950650294 3:14402879-14402901 CTGCAGACGGCGGGCAGCGCCGG - Intronic
952316665 3:32238378-32238400 CCGCAGCCCCCGACCCGCCCAGG + Intergenic
954150813 3:48656213-48656235 GCGCAGCCACCTCGCAGCGCGGG + Exonic
954277949 3:49554645-49554667 CCGCTGCCGCCCGGCGGCGCCGG + Exonic
961443102 3:126964510-126964532 CCGCAGGTGCCGAGCATGGCTGG - Intergenic
964771120 3:160225437-160225459 CCGCAGCCTCCGCGCGCCGCGGG + Intergenic
966096831 3:176213767-176213789 CCGCAAGCGCCGCGCAGCCCCGG + Intergenic
967930433 3:194686790-194686812 CCGCCGCCGCCCAGCTGCGCCGG + Exonic
968405772 4:338079-338101 CCGCTGCCGCCGCTCAGCCCTGG + Intronic
968699286 4:2047096-2047118 GGGGAGCCGCCGAGCAGCCCAGG - Intergenic
968705355 4:2075070-2075092 CCGCAGCCCCCAATCAGCCCAGG + Intronic
968965147 4:3765923-3765945 CCGCCGCCGCCGCCCTGCGCTGG - Intergenic
969396812 4:6927103-6927125 CCACAGCCTCCCAGAAGCGCAGG + Intronic
969715845 4:8867775-8867797 CCGGAGAAGCCGAGCAGCGGTGG + Exonic
970637108 4:18021677-18021699 CCGCCGCCGCCGCTCAGTGCCGG - Exonic
970823862 4:20251738-20251760 CCGCCGCCTCCGCCCAGCGCTGG + Intergenic
971257937 4:25030898-25030920 CGGCGGCCGCCCAGCAGCCCGGG - Intergenic
973694506 4:53476823-53476845 CTGCAGCAGCCCAGCAGCCCTGG - Exonic
975401503 4:73944283-73944305 CCGCAGTAGCCGGGGAGCGCGGG + Intergenic
977065076 4:92304303-92304325 CCGCGGCCCCCGCGCAGCGATGG + Intergenic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
985248171 4:187997054-187997076 CTGCAGCCCCCGGGGAGCGCCGG + Intronic
985532500 5:442516-442538 CCTCAGAGGCCCAGCAGCGCAGG - Exonic
985972548 5:3389782-3389804 CAGCAGGCGCCAAGCAGCTCTGG + Intergenic
990410333 5:55535033-55535055 CCCCTCCCGCTGAGCAGCGCAGG + Intronic
992597439 5:78360566-78360588 TCGCCGCCGCCGAGCAGATCCGG - Exonic
994107246 5:95961436-95961458 CCGCAGCGGCCAGGCAGGGCAGG - Intronic
996543294 5:124651887-124651909 CCGAGGGAGCCGAGCAGCGCAGG - Intronic
998407103 5:141880136-141880158 CAGCAGCCGCAGAGCTGGGCAGG + Intergenic
998887178 5:146706601-146706623 TCGCAGATGCGGAGCAGCGCAGG - Intronic
999272081 5:150302539-150302561 CCGCTGCGGCCGAGCAGATCCGG - Exonic
1000220522 5:159209542-159209564 CCGCGGCCGCCGCAGAGCGCCGG - Intronic
1001332246 5:170770608-170770630 CCTTAGCCGCTGAGCAGGGCTGG - Intronic
1002895553 6:1378269-1378291 CAGCCGCCGCCGGGCACCGCGGG - Intergenic
1003593686 6:7456382-7456404 CCGCAAGCGCCGCGCAGCCCCGG - Intergenic
1004044612 6:12012206-12012228 CCGCAGCCGCCGGGCGGAGGAGG - Intronic
1004228870 6:13813832-13813854 CCACCGCGGCCGAGCAGGGCGGG + Intronic
1006084523 6:31586767-31586789 CCTGAGCCGCAGAGCAGCGCGGG - Intronic
1006950824 6:37819928-37819950 CCGCCGCCGCCGAGCACCATGGG + Exonic
1008760426 6:54846784-54846806 CCGCGCCCGCCGCACAGCGCCGG - Exonic
1016356750 6:143226902-143226924 CCGCAGCCGACATGCAGCCCAGG + Intronic
1018942726 6:168319856-168319878 CCGCAGCCGGCGAGGGGCCCTGG - Intergenic
1022020881 7:26398547-26398569 CCCCAGCCGCCGAGCCGGGCCGG - Intergenic
1026928871 7:74211880-74211902 CCGCACCCGGCCAACAGCGCAGG + Intronic
1027956020 7:84880603-84880625 CCGCAAGCGCCGCGCAGCCCGGG - Intergenic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1034446161 7:151115272-151115294 CCGCGCCCGCCGCGCAGCACTGG - Intronic
1034469770 7:151248953-151248975 CCGAAGCCGCCGAGGCCCGCGGG + Exonic
1038554027 8:28494243-28494265 CCGGAGCGGCCGAGGAACGCCGG - Exonic
1039996754 8:42541319-42541341 CCGCCGGCGCCGACCAGCCCTGG + Intronic
1042040276 8:64581750-64581772 CTGCAGCCGCCGAGCTGGGCAGG - Exonic
1042611824 8:70608349-70608371 ACGCAGCCGCCGGGCCGCCCGGG + Exonic
1043502808 8:80873845-80873867 CCGCCGCCGCCGCGCAGCGCCGG - Intronic
1047251785 8:123186413-123186435 CCTCAGCCCCCGAGCGGAGCCGG + Intronic
1048214263 8:132480863-132480885 CCGCCGCCGCCCCGGAGCGCCGG - Exonic
1049095305 8:140545000-140545022 CTGCAGCAGCCGAGCAAGGCTGG - Intronic
1049583467 8:143422803-143422825 CCGCGGCCGGGGAGGAGCGCCGG - Intronic
1049989423 9:977384-977406 CCGCGGCCGCCGCGCTGCGTTGG + Exonic
1052362164 9:27573223-27573245 CCGCCGCCGCCGGGAAGCCCGGG + Intronic
1053434818 9:38067947-38067969 CCTCAGCCGCGGAGGAGAGCGGG - Exonic
1056386273 9:86099577-86099599 GCCCCGCCCCCGAGCAGCGCCGG + Intronic
1056406638 9:86282036-86282058 CCGGAACGGCCGAACAGCGCAGG + Intronic
1057478644 9:95426804-95426826 CCGCAGCCGCCGCGCAGGCAGGG - Intergenic
1057596141 9:96417718-96417740 CCGCAGCCGCCGAGCACTCGGGG - Exonic
1057739190 9:97697136-97697158 CCGCCGTCGCCGAGTAGGGCCGG + Exonic
1060479291 9:124008681-124008703 CCGCAGCCTTCGGGGAGCGCCGG + Intronic
1060979820 9:127785682-127785704 CCGCCTCCGCCGGGCTGCGCGGG - Intronic
1061149151 9:128819112-128819134 CCGCCGCCGCCAACCACCGCTGG + Exonic
1061378113 9:130238078-130238100 CCGCAGCAGCAGCGCAGCCCAGG - Intergenic
1062070186 9:134551232-134551254 CCGCAGCTGCGGGGCAGAGCTGG + Intergenic
1062084627 9:134642275-134642297 GCGCCGCCTCCGAGCCGCGCAGG + Exonic
1062421301 9:136483887-136483909 CCGCGGGCACCGAGCGGCGCCGG + Exonic
1186660567 X:11664689-11664711 CCGCAGCCGCCGATCAGGGCCGG + Exonic
1192847961 X:74925278-74925300 CCGCAGCCACCGCACAGAGCGGG - Exonic