ID: 1153688333

View in Genome Browser
Species Human (GRCh38)
Location 18:7567675-7567697
Sequence CTGTTGGCACTTTGGGGGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 333}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153688319_1153688333 22 Left 1153688319 18:7567630-7567652 CCTGTGCCCGCGCCCCTGGAGCC 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688316_1153688333 29 Left 1153688316 18:7567623-7567645 CCAGGACCCTGTGCCCGCGCCCC 0: 1
1: 0
2: 3
3: 41
4: 431
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688327_1153688333 1 Left 1153688327 18:7567651-7567673 CCGCTGGAGTTCGGACTTCTGCA 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688318_1153688333 23 Left 1153688318 18:7567629-7567651 CCCTGTGCCCGCGCCCCTGGAGC 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688323_1153688333 10 Left 1153688323 18:7567642-7567664 CCCCTGGAGCCGCTGGAGTTCGG 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688321_1153688333 16 Left 1153688321 18:7567636-7567658 CCCGCGCCCCTGGAGCCGCTGGA 0: 1
1: 0
2: 2
3: 26
4: 270
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688326_1153688333 8 Left 1153688326 18:7567644-7567666 CCTGGAGCCGCTGGAGTTCGGAC 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688325_1153688333 9 Left 1153688325 18:7567643-7567665 CCCTGGAGCCGCTGGAGTTCGGA 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688315_1153688333 30 Left 1153688315 18:7567622-7567644 CCCAGGACCCTGTGCCCGCGCCC 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333
1153688322_1153688333 15 Left 1153688322 18:7567637-7567659 CCGCGCCCCTGGAGCCGCTGGAG 0: 1
1: 0
2: 2
3: 30
4: 272
Right 1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG 0: 1
1: 0
2: 4
3: 37
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153688333 Original CRISPR CTGTTGGCACTTTGGGGGCT TGG Exonic
900428552 1:2591634-2591656 CTGTGGGCATGTTGGGGGCGTGG + Intronic
901729533 1:11269231-11269253 CTGTTGGGGGTTGGGGGGCTGGG - Intergenic
901869265 1:12127962-12127984 CTGGTGGGACCTTGGGGTCTGGG + Intronic
905432024 1:37931530-37931552 CTGGTGGCCCTCTGGAGGCTGGG - Intronic
906674611 1:47684218-47684240 ATGAGAGCACTTTGGGGGCTGGG - Intergenic
907684395 1:56595779-56595801 CTGTTGGGGGTTGGGGGGCTAGG - Intronic
908209076 1:61881290-61881312 CTGTGGGGACTTTGTGTGCTGGG + Intronic
910009176 1:82439390-82439412 CTGTTGGTATGTGGGGGGCTAGG + Intergenic
911830982 1:102551024-102551046 CTTTTTGCAGTTTGGGGACTTGG - Intergenic
914966113 1:152259096-152259118 CTGTCGGGGGTTTGGGGGCTAGG - Intergenic
915324408 1:155073550-155073572 CTGCTGCCACTTTGGGAGCCAGG - Intergenic
915612930 1:157009475-157009497 CAGTTGGCACTTTGTGGATTTGG - Intronic
915750065 1:158198935-158198957 CTGTTGGCACTTTGGTGGCCAGG + Intergenic
917042141 1:170816756-170816778 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
917230283 1:172829350-172829372 CTGTTGGGGGGTTGGGGGCTAGG - Intergenic
917729542 1:177861080-177861102 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
917744229 1:177992027-177992049 CTGTTGGGGGTTGGGGGGCTGGG + Intergenic
918062861 1:181077287-181077309 CTGTTGATACTTTGGGGGCACGG + Intergenic
919437149 1:197575925-197575947 CTGTTGGCAGGTAGGGGCCTGGG + Intronic
920070688 1:203301039-203301061 CTGTTGGGCCTGTGGGGACTTGG - Intergenic
921450675 1:215302177-215302199 CTGTTGGCAGGTGGGGGACTAGG + Intergenic
922159354 1:223067177-223067199 CCCTTGGCAGTTTGGGGGCCTGG + Intergenic
922219041 1:223543908-223543930 ATGCTGGCACCTTGGGGGCGAGG - Intronic
922766053 1:228157235-228157257 CTGGTGGCACTTTGGGGTCTGGG + Intronic
922792435 1:228317695-228317717 CTGTGGGCCCTGTGGGTGCTGGG + Exonic
923604855 1:235433967-235433989 CTGTGGGCACTTTGAGGCCTTGG - Intronic
924551354 1:245080931-245080953 CTGCTGACACATTGGCGGCTAGG - Intronic
1063653468 10:7963653-7963675 CTGTTGGGAGGTCGGGGGCTGGG + Intronic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1068028130 10:51674324-51674346 CTGTTGGGGGATTGGGGGCTAGG - Intronic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1069761156 10:70812523-70812545 CTCTTGGCTCTCTGAGGGCTTGG + Intergenic
1070373978 10:75811183-75811205 TTGCTGACACTTTGGGGCCTTGG - Intronic
1071965229 10:90845172-90845194 CTGATGGCACTTTTTGGGATGGG + Intronic
1073595859 10:104799538-104799560 CTGTTGGGGGTTGGGGGGCTAGG + Intronic
1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG + Intronic
1077250327 11:1557990-1558012 CTGTTGGCAGTTGGGCGGGTGGG - Intronic
1077880385 11:6344616-6344638 CTGTTGACACTTTGGAAACTCGG + Intergenic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1078587971 11:12610479-12610501 CTGCGGCCACTTTGGGGGATGGG - Intergenic
1078794456 11:14578068-14578090 CTGTTGGGGGGTTGGGGGCTAGG + Intronic
1079424165 11:20324591-20324613 CTGTTGGGGGGTTGGGGGCTAGG - Intergenic
1079591888 11:22192506-22192528 CTGCTGGCACCTTGGAGTCTCGG + Intergenic
1080200552 11:29664538-29664560 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
1080220773 11:29900995-29901017 CTGTTGGGAGTTGGGGAGCTAGG - Intergenic
1081173920 11:39902426-39902448 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
1081934410 11:46895136-46895158 CTGTTGGCACTTGGCTGGGTGGG - Intronic
1083719848 11:64598764-64598786 CTGTTGGCACTGGGGGCGCCAGG - Intronic
1084101650 11:66953716-66953738 TTTTTGGCACTTTGTGGGCAGGG - Intronic
1085728741 11:78978197-78978219 CTGTTGGCGGATGGGGGGCTAGG + Intronic
1086869359 11:92018310-92018332 CTGTAGCCACTATGGGGGATGGG + Intergenic
1088030091 11:105237966-105237988 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1088175799 11:107051555-107051577 CTGTTTGCAGTCTGGGGACTTGG + Intergenic
1088357091 11:108955687-108955709 CTGTTGGGAGTTGGGGGGCAAGG + Intergenic
1088617268 11:111643301-111643323 CTGTTGGAAGGTTGGGGGCGAGG + Intronic
1090031682 11:123211730-123211752 CTCTTGGCACTTTAGGGACTGGG - Intergenic
1090070996 11:123544768-123544790 TTTTTGGCACTTTGGGGCCCGGG - Intronic
1090576786 11:128113398-128113420 CTGTCGGCAGGTGGGGGGCTGGG + Intergenic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1092214787 12:6673347-6673369 ATGTGGGCACTTGTGGGGCTTGG + Exonic
1092579089 12:9819970-9819992 CTGTTGTCACTTTTGGGCGTTGG + Intergenic
1093361507 12:18234991-18235013 CTGTTAGGAGTTTGGGGGCAAGG - Intronic
1093610244 12:21147429-21147451 CTGTTGGGGGTTGGGGGGCTAGG - Intronic
1093902449 12:24651385-24651407 CTGTTGGCGGGTGGGGGGCTAGG - Intergenic
1094252510 12:28380168-28380190 CTGTTGGGGGTTGGGGGGCTGGG + Intronic
1094432068 12:30380369-30380391 CTGCTGGTACTTGGGGGTCTGGG - Intergenic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1094820751 12:34222359-34222381 CTGTTGGCAATTTTGGGTTTGGG + Intergenic
1095117265 12:38369602-38369624 CTTTGGGGACTTTGGGGACTTGG - Intergenic
1097064795 12:56313128-56313150 CTGTTGGGGTGTTGGGGGCTAGG - Intronic
1097370923 12:58779780-58779802 CTGTGGGAAGCTTGGGGGCTAGG - Intronic
1097622865 12:61962896-61962918 CTGTTGGCTGGTGGGGGGCTAGG - Intronic
1099749710 12:86757210-86757232 CTGTTGGGGGTTGGGGGGCTAGG + Intronic
1099886427 12:88536828-88536850 CTGTTGGGTATTGGGGGGCTAGG + Intronic
1100076618 12:90792733-90792755 CTGTTGGGGGGTTGGGGGCTAGG - Intergenic
1102041693 12:109805146-109805168 CTGTGGGCACCTTGAGGGCAGGG + Intronic
1102402729 12:112644324-112644346 CTGTTTGCACTGTGGGTGATTGG + Intronic
1103140974 12:118547963-118547985 CTGTTGGAAGGTGGGGGGCTGGG + Intergenic
1103945248 12:124522684-124522706 CTGCTGCCACTTTGAGGTCTTGG - Intronic
1104192354 12:126494286-126494308 CTCTTGGCACAGTGAGGGCTGGG + Intergenic
1104734994 12:131131163-131131185 CTGTTGGGACCTATGGGGCTGGG - Intronic
1104937903 12:132376368-132376390 CTGTTGGCACCTTGATGGCTGGG - Intergenic
1105022348 12:132825435-132825457 GTGTTGGCACTTTAGGAGTTGGG - Intronic
1106094432 13:26630306-26630328 CTGTTGGGGGTTGGGGGGCTGGG - Intronic
1106285321 13:28313554-28313576 CTGTAAGCACTATGTGGGCTGGG + Intronic
1106767595 13:32930488-32930510 CTGTTGGGGCATGGGGGGCTAGG - Intergenic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1107732340 13:43360870-43360892 CAGTTAGCAATTTGGGGGCTGGG - Intronic
1109395051 13:61745742-61745764 CTGTTGGGGGTTGGGGGGCTGGG + Intergenic
1109640590 13:65186187-65186209 CTGTTGGGAGTTGGGGGCCTAGG + Intergenic
1110408276 13:75175130-75175152 CTGTTGGGGAGTTGGGGGCTAGG - Intergenic
1110510991 13:76350272-76350294 CTGTTGGGGGTTGGGGGGCTGGG - Intergenic
1110571527 13:77010097-77010119 CTGTCGGGAGTTGGGGGGCTAGG + Intronic
1111017923 13:82405242-82405264 CTGTTGGGAGGTGGGGGGCTAGG + Intergenic
1112461312 13:99606131-99606153 CTGTTGGCACTCTCTGGGCAGGG - Intergenic
1113136066 13:107090865-107090887 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
1114869569 14:26639966-26639988 CTGTTGGGAGGTGGGGGGCTAGG - Intergenic
1115671895 14:35622358-35622380 CTGTTGGGGGATTGGGGGCTGGG + Intronic
1116717234 14:48442953-48442975 CTGTTGGGGAGTTGGGGGCTAGG + Intergenic
1117266406 14:54092206-54092228 CTGGTGGCATTTTGTGGTCTAGG - Intergenic
1117646636 14:57860141-57860163 CTCTTGGCTCTCTGGGTGCTTGG - Intronic
1117875237 14:60245370-60245392 ATGTTGGCTCTTTGTGGGCAGGG + Intergenic
1120088093 14:80298118-80298140 CTGTCGGGGGTTTGGGGGCTGGG + Intronic
1121047331 14:90797560-90797582 CTGTTAGCACTCTGGAGGCAGGG - Intronic
1121416988 14:93786587-93786609 CTGATGGCATTTTGGGGTTTGGG - Intronic
1121701788 14:95960326-95960348 CTGTTGGGGCATGGGGGGCTAGG + Intergenic
1122137901 14:99645232-99645254 CTGCTGGCGCTTTGGGTGCTCGG + Exonic
1122730943 14:103797606-103797628 CTGTAGGCATTTTGGGGGCGGGG - Intronic
1123076758 14:105671306-105671328 CTGTAGGAAATTGGGGGGCTGGG + Intergenic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1127329852 15:57928087-57928109 CTGTTGGAAGGTTGGGGGATAGG - Intergenic
1127846808 15:62877515-62877537 CTCTTGGCCGTTTGGGTGCTGGG + Intergenic
1130261603 15:82358623-82358645 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
1130279632 15:82510389-82510411 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1130471011 15:84226574-84226596 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1130478505 15:84341144-84341166 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1130493265 15:84446987-84447009 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
1130593301 15:85231211-85231233 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1131228520 15:90644258-90644280 CTTTTGGCACATGGGGTGCTGGG - Intronic
1131361890 15:91800231-91800253 CTGTTGGTGGGTTGGGGGCTAGG - Intergenic
1135790114 16:25386196-25386218 CTGTTGGCGGGTGGGGGGCTAGG - Intergenic
1136401784 16:30023268-30023290 CTGATGGCACTTTGGGGTGAGGG - Intronic
1138850067 16:60617299-60617321 CAGTGGGCACTTTGGGCTCTGGG + Intergenic
1140465052 16:75174833-75174855 CTGTTGACACTATGGTGCCTGGG - Intergenic
1140594540 16:76393517-76393539 CTGTGAGCACTTTGGGGCCCAGG - Intronic
1141144101 16:81516691-81516713 CTGTGGGCTCCCTGGGGGCTGGG + Intronic
1142564308 17:829618-829640 CTGTTGGCAGGTGGGGGCCTAGG - Intronic
1144004997 17:11091592-11091614 CATTTGGCACTTTGTTGGCTTGG + Intergenic
1145124634 17:20290093-20290115 CTGGTGGTGCTCTGGGGGCTCGG - Intronic
1145248927 17:21286869-21286891 CTGTAGTCTCTTTGGGGTCTGGG + Intronic
1150368192 17:64610601-64610623 CTGTTGGCGGGTTGGGGGTTAGG + Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1151221597 17:72616755-72616777 GTCTTGGCATGTTGGGGGCTTGG + Intergenic
1152925157 17:83084310-83084332 GTGTTGGCAGTTTGGGGGGAAGG - Intronic
1153288896 18:3481190-3481212 CTGTGTGCAGTTTGGGAGCTTGG + Intergenic
1153393023 18:4584643-4584665 CTGTTGGGAGGTGGGGGGCTGGG + Intergenic
1153642582 18:7169585-7169607 CTATGGGCATTTTGGGGACTTGG + Intergenic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154074949 18:11191226-11191248 CTCTTGGCAGTTTGGGAGATGGG + Intergenic
1155488876 18:26378157-26378179 CTGTTGGCATTTTGTGGCTTGGG + Intronic
1155825741 18:30440363-30440385 CTGTTGGCAGGTTGGGGGCCAGG - Intergenic
1156034993 18:32756077-32756099 ATGTAGTCACTTTGGGGGTTAGG - Intronic
1156166189 18:34424107-34424129 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1157255383 18:46134120-46134142 ATGTTATCAATTTGGGGGCTGGG + Intergenic
1157274031 18:46297431-46297453 CTGGTGGGAATTTGTGGGCTGGG + Intergenic
1159320199 18:66838440-66838462 CTGTTGTCACTCTTGGGTCTGGG - Intergenic
1159335444 18:67058568-67058590 CTGTTGGGGCTTGCGGGGCTAGG - Intergenic
1161453283 19:4358272-4358294 CTGGTGGCGCCTTGGGGGCCTGG + Intronic
1163691096 19:18738945-18738967 CTGGGGGCACTTTGGGGCTTGGG + Intronic
1163963705 19:20723233-20723255 CTTATTGGACTTTGGGGGCTGGG + Intronic
1164138511 19:22436401-22436423 CTGTTGGGAGGTTGGGGGCAAGG - Intronic
1164567204 19:29334828-29334850 CTGTTGGGAGTTCGGGGGCAAGG - Intergenic
1164752725 19:30668646-30668668 CTGATGGCTCCCTGGGGGCTCGG + Intronic
1166531299 19:43545106-43545128 CTGATGCCACTTTAGGGGCTTGG + Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1168152066 19:54454641-54454663 CTGTTGGCCCTTCTTGGGCTTGG - Exonic
924975070 2:165332-165354 CTGTTGGGAGTTAGGGGTCTAGG + Intergenic
925484054 2:4308637-4308659 CTGTTGGGGGATTGGGGGCTAGG - Intergenic
925971959 2:9112284-9112306 CTGTTGACACATTGCAGGCTCGG - Intergenic
926401274 2:12499660-12499682 ATGCTGGCACTTTGGAGGCAGGG - Intergenic
926848212 2:17165617-17165639 CTGTTGGGGGGTTGGGGGCTAGG - Intergenic
927216559 2:20670802-20670824 CCGTTGGCACTGCGGCGGCTGGG + Exonic
927857504 2:26536690-26536712 CGCTTGGCTCTGTGGGGGCTGGG - Intronic
927870300 2:26618939-26618961 CTTTGGGCACTTTGGGCACTTGG + Intronic
928255993 2:29723127-29723149 CTGTGGGGCCTTTAGGGGCTAGG - Intronic
928701459 2:33903245-33903267 GGGGTGGAACTTTGGGGGCTGGG + Intergenic
928748420 2:34442891-34442913 CTGTGGGCATTTTGGGGTCCAGG + Intergenic
929144880 2:38697926-38697948 CTGTTGGCAATTTTGGGTTTTGG + Intronic
929948103 2:46385725-46385747 CTGATGGCACGTTGTGGGGTCGG + Exonic
930270283 2:49248153-49248175 CTGTTGGCAGGTGGGGGCCTGGG + Intergenic
930625184 2:53688778-53688800 CTGTTGGGAGGTGGGGGGCTAGG + Intronic
931556582 2:63512736-63512758 CTGTTGGGAGTTGGGGGGCAAGG + Intronic
932052352 2:68411162-68411184 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
934986481 2:98890759-98890781 CATTTGAAACTTTGGGGGCTGGG + Intronic
935730076 2:106057889-106057911 CTGTCGGCGGGTTGGGGGCTAGG + Intergenic
935848801 2:107196293-107196315 CTGTTGGCATTTAGAAGGCTAGG + Intergenic
937415337 2:121710219-121710241 CTGATGCCACTGTGGGGGTTAGG - Intergenic
938074117 2:128322801-128322823 TTGTTGGCAAGTGGGGGGCTTGG + Intergenic
938376665 2:130812272-130812294 CTGTTGGGGCCTGGGGGGCTGGG - Intergenic
938837203 2:135118095-135118117 ATCTTGGCACTTTGGGAGGTTGG - Intronic
939045059 2:137240056-137240078 ATGTTTTCACTTTGGGGGTTAGG + Intronic
940437832 2:153675538-153675560 CTGTTGGCAGGTGGGGGGCTGGG + Intergenic
941315805 2:163990955-163990977 CTGTTGGCACTTAGAGGCCATGG + Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941902495 2:170691794-170691816 CTGTGGGCTCCTTGGGGGCAGGG - Intergenic
942528516 2:176882423-176882445 CTGTTGGGAAGTTGGGGGCTGGG + Intergenic
942766476 2:179463500-179463522 CTGTTGGGGAGTTGGGGGCTAGG - Intronic
942832397 2:180252581-180252603 CTGTTGGAAGGTTGGGGGCTAGG - Intergenic
942851396 2:180492195-180492217 CTGTTGGCAGGTGAGGGGCTAGG - Intergenic
944824045 2:203462946-203462968 ATCCTGGCACTTTGGAGGCTGGG + Intronic
946366297 2:219251161-219251183 CTGTAGACACCTGGGGGGCTGGG + Exonic
946369374 2:219271306-219271328 CTGTAGACACCTGGGGGGCTGGG - Intronic
947135344 2:226972075-226972097 CTGTTGGGAGTTAGGGGGCAAGG - Intronic
948487658 2:238291099-238291121 CTGTTGGCACTGTGGGAGGCAGG + Intergenic
1172385797 20:34533258-34533280 CTGTTGGCTACTTAGGGGCTGGG - Intronic
1172597417 20:36159022-36159044 CTGTGGGGACTTGGAGGGCTGGG + Intronic
1174032918 20:47645074-47645096 CTGGTTGCATTTTGGGAGCTGGG + Intronic
1175175477 20:57109259-57109281 CTGCTGGCTCTGTGGGGACTGGG - Intergenic
1175957843 20:62620814-62620836 CTGTTAGCACTCGGGGGGCGGGG + Intergenic
1177537485 21:22447500-22447522 CTGTTGGGAGTTGGGGGGCTTGG - Intergenic
1180261914 21:46676558-46676580 CTGTTGGGGGATTGGGGGCTAGG - Intergenic
1180848580 22:18998212-18998234 CTGCTGGCAATTTGGGGGTGGGG + Intergenic
1182851908 22:33482539-33482561 CTGTCGGGAGGTTGGGGGCTAGG + Intronic
1183411079 22:37655420-37655442 GGGGTGGCACTGTGGGGGCTCGG - Exonic
1184094269 22:42308203-42308225 CTATAGGCACCTTGGGGGCCAGG - Intronic
1184746564 22:46459564-46459586 CTGCTGGCACTGTGGAGGGTGGG - Intronic
1184926319 22:47642280-47642302 CTGCTGGCACTGTGGTGGGTGGG - Intergenic
1184975674 22:48059889-48059911 CTGTTGGGGAGTTGGGGGCTAGG + Intergenic
951431385 3:22611299-22611321 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
952112067 3:30135539-30135561 ATGTTGGAACTTTTGAGGCTGGG + Intergenic
952514676 3:34091847-34091869 TTGTTTGCACTTTGAGGGATAGG + Intergenic
952955649 3:38555748-38555770 CTCTTTGCACTTAGGGGGCCAGG - Exonic
953433947 3:42863853-42863875 CTGTTGGGGGATTGGGGGCTAGG + Intronic
953719391 3:45342050-45342072 CTGGTGGCACACTGGTGGCTGGG + Intergenic
954375384 3:50191715-50191737 CTGCTGGGACCATGGGGGCTGGG + Exonic
954810128 3:53242420-53242442 CTCCTGGCAGTTTGGGGCCTGGG + Intronic
955210614 3:56937012-56937034 CTTTTGAAACTTTGGAGGCTGGG - Intronic
955517040 3:59736278-59736300 ATCTTGGCACTGTGGAGGCTTGG - Intergenic
957025778 3:75180083-75180105 CTGTTAGCACCTTGAGGGCAAGG - Intergenic
957384015 3:79471929-79471951 CTGTTGGGGGTTGGGGGGCTAGG + Intronic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
957841728 3:85679602-85679624 CTGTTTTCACTTTGGGGGAATGG + Intronic
958767275 3:98384543-98384565 GGGTTGGTTCTTTGGGGGCTTGG + Intergenic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
963771464 3:149390659-149390681 CTGTGGGAACTTTAGGGACTTGG + Intergenic
964400382 3:156291727-156291749 CTTGTGCCACTTTGTGGGCTTGG + Intronic
964443555 3:156737375-156737397 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
964648524 3:158985743-158985765 CTGTTGGGGGGTTGGGGGCTGGG - Intronic
968056401 3:195695262-195695284 CTGTTGGGAGGTTGGGGGCAAGG - Intergenic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
970685768 4:18565356-18565378 CTGTTGGTAGGTTGGGGGCTAGG + Intergenic
970784463 4:19779996-19780018 CTGTCGGGAGTTCGGGGGCTAGG - Intergenic
972016215 4:34249456-34249478 CTGTTGGGAGGTGGGGGGCTAGG - Intergenic
972831937 4:42824132-42824154 CTGTTGGGGGTTGGGGGGCTGGG + Intergenic
973590372 4:52434740-52434762 CTGTTGGCGGGTGGGGGGCTAGG - Intergenic
975097196 4:70470251-70470273 CTGTTGGCAGGTGGGGGGCTGGG + Intronic
975508381 4:75165115-75165137 CTGTTGGGGGGTTGGGGGCTGGG - Intergenic
975985219 4:80196641-80196663 CTGTTGGCACTCTGAGGTCTTGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978666789 4:111193810-111193832 CTGTTGGGAGGTGGGGGGCTAGG + Intergenic
978699232 4:111622891-111622913 CTTTTGGCAGGTGGGGGGCTAGG - Intergenic
978717698 4:111866092-111866114 CTGTTGGGGGGTTGGGGGCTGGG - Intergenic
978760948 4:112356178-112356200 CTGTTGGCATTTGTAGGGCTGGG - Intronic
978939043 4:114415382-114415404 CTGTGGGCACTCTAGGGACTTGG + Intergenic
979584868 4:122403979-122404001 TTGTTGGCTGTGTGGGGGCTGGG - Intronic
979609859 4:122678240-122678262 CTATTGGCATTTTGGAGACTGGG - Intergenic
980567985 4:134571003-134571025 CTGTCGGCAGTTGGGGGGCTAGG - Intergenic
981238996 4:142452050-142452072 CTGTCGGCAGGTGGGGGGCTAGG - Intronic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
982472046 4:155804356-155804378 CTGTTGGGAGTTTGGGGGCAAGG + Intronic
985650312 5:1104537-1104559 CTCTGGGAAGTTTGGGGGCTGGG - Intronic
986050013 5:4081282-4081304 CTGTTGCCTGTTTGGGGACTAGG + Intergenic
986058632 5:4164985-4165007 GTTTTGGCACATTGGTGGCTTGG + Intergenic
987135928 5:14899407-14899429 CTGTTGGGATGTGGGGGGCTAGG - Intergenic
987180449 5:15362093-15362115 CTGTTGGGGGTTGGGGGGCTGGG + Intergenic
987688128 5:21231242-21231264 CTGTCGGGGCTTGGGGGGCTAGG + Intergenic
987966787 5:24887636-24887658 CTGTTGGCAGGTGGGGGGCTGGG + Intergenic
988309199 5:29536312-29536334 CTGTTGGGAGGTGGGGGGCTCGG - Intergenic
988420922 5:31005398-31005420 CTGTTGGCATCTGGGGGGCTAGG - Intergenic
988693235 5:33593674-33593696 CTGTAGGGAGTTGGGGGGCTAGG + Intronic
990536423 5:56727618-56727640 ATACTAGCACTTTGGGGGCTAGG + Intergenic
991671158 5:69049123-69049145 CTGTAAGCACTTTGAGGGCAAGG - Intergenic
992288471 5:75260308-75260330 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
992340915 5:75822610-75822632 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
993330828 5:86597832-86597854 CTGTTGGGAGGTGGGGGGCTAGG + Intergenic
993722135 5:91332095-91332117 CTCTTAGCACTTTGGGAGGTGGG - Intergenic
994310689 5:98267037-98267059 CTGTTGGGAGCTGGGGGGCTGGG + Intergenic
994347201 5:98700844-98700866 CTGTGGGCTGTATGGGGGCTGGG + Intergenic
994410078 5:99396257-99396279 CTGTTGGGGGTTGGGGGGCTGGG + Intergenic
994483743 5:100369024-100369046 CTGTTGGGGCTTGGGGGGCTGGG - Intergenic
994706989 5:103219104-103219126 CTGTTGGGAGGTTGGGGGCTAGG - Intergenic
995621163 5:114027223-114027245 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
995849337 5:116528646-116528668 CTGTTTGCATTTTGGAAGCTTGG - Intronic
995963493 5:117874871-117874893 CTGTTGGGGATTGGGGGGCTAGG - Intergenic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996204955 5:120722020-120722042 CTGTTGGCAGGTAGGGGGCTAGG - Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
997060851 5:130500852-130500874 CTGTCGGGAGTTGGGGGGCTAGG - Intergenic
997217205 5:132122673-132122695 CTGTCGGGAAGTTGGGGGCTAGG + Intergenic
997807053 5:136928405-136928427 CTGTTGGGAGATGGGGGGCTAGG - Intergenic
998108154 5:139481595-139481617 CTGGTGACCCTTTGGGGGCTAGG - Exonic
998331687 5:141332892-141332914 CGGTTCGCACTTTGTGGGCGTGG + Exonic
999057579 5:148596507-148596529 ATGCTGGCATTTTGGGGGCTGGG + Intronic
999670994 5:153959167-153959189 CAGTTGCCTCTTTGGGGCCTGGG + Intergenic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000816650 5:165930731-165930753 CTGTTGGGGGTTGGGGGGCTGGG + Intergenic
1001345824 5:170897557-170897579 CTGTTGGGGGTTGGGGGGCTAGG - Intronic
1001378261 5:171283266-171283288 CTGTAAGCTCTTTGAGGGCTGGG + Intronic
1002157852 5:177296798-177296820 CTGTTGGCAGTCTGTGAGCTGGG - Exonic
1003081388 6:3024316-3024338 CTGTTAGCAATTCGAGGGCTGGG + Intergenic
1004299697 6:14446064-14446086 ATGTTGGCACTATTGGGGCTAGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005356861 6:24992931-24992953 CTGGTGGCACTTTGTTTGCTTGG - Intronic
1007520757 6:42450783-42450805 CTGCGGGCTCTGTGGGGGCTGGG - Intronic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1008788461 6:55198820-55198842 CTGATGGCAGTATGGGGACTAGG - Intronic
1009794477 6:68450136-68450158 CTGTTGGGGGGTTGGGGGCTGGG - Intergenic
1010085908 6:71917884-71917906 ATGTTTCCACTTTGGGGCCTGGG + Intronic
1010762645 6:79741287-79741309 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
1011203800 6:84869213-84869235 CGGGTAGCTCTTTGGGGGCTAGG - Intergenic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1013820650 6:114149575-114149597 CTGTTGGCAGGTGGGGGGCAGGG + Intronic
1014904105 6:127005473-127005495 CTGTTGGCGGGTGGGGGGCTAGG - Intergenic
1015557263 6:134476201-134476223 CTGTCGGCGGGTTGGGGGCTGGG - Intergenic
1018223219 6:161602856-161602878 CTGTGGGCTCTTTGAGGGCAAGG - Intronic
1018343503 6:162877429-162877451 CTGTTGGGAGGTTGGGGGCTAGG + Intronic
1019660236 7:2219975-2219997 CTGATGGGACTTTGGGAGCGTGG - Intronic
1020475324 7:8587632-8587654 CTGTTGGGCGGTTGGGGGCTAGG - Intronic
1020854219 7:13396762-13396784 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1020905772 7:14062472-14062494 CTGTTGGGAGGTGGGGGGCTAGG + Intergenic
1022174425 7:27859713-27859735 CTGTTGGGGCATGGGGGGCTAGG + Intronic
1023375743 7:39553183-39553205 TAGATGGCACTTTGGGGGCAGGG - Intergenic
1024207172 7:47173668-47173690 CTGTTGGCACATGGAGGGCATGG + Intergenic
1026569844 7:71520060-71520082 CTGTGAGCTCTTTGAGGGCTGGG - Intronic
1027854198 7:83487988-83488010 GTGTTGGCACTTTGCACGCTAGG + Intronic
1028019906 7:85757105-85757127 CTGTTGGGGCATGGGGGGCTAGG + Intergenic
1029053316 7:97712567-97712589 CTGTTGGGGGATTGGGGGCTGGG + Intergenic
1030331198 7:108272894-108272916 CTGTTGGCAGGTGGGGGGCTGGG - Intronic
1030462564 7:109858663-109858685 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
1030926802 7:115467009-115467031 CTGTTGGGGGTTTGGGGGCTAGG + Intergenic
1031145060 7:117988494-117988516 CTATTGGCGCTTTGGGTTCTTGG + Intergenic
1032654110 7:133908984-133909006 CTGTCGGGAGTTAGGGGGCTAGG - Intronic
1036205548 8:6803184-6803206 CTGATGGCAGTTGGGGGGTTGGG + Intergenic
1040747347 8:50661698-50661720 CTGTTGGGAGGTTGGGGGCAAGG - Intronic
1041346768 8:56907216-56907238 CTGTTAGCACTTAGGGGTCATGG + Intergenic
1041976752 8:63808089-63808111 CTGTTGGCAGTTTGTAGGATTGG - Intergenic
1043243845 8:77973325-77973347 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
1045415941 8:101967700-101967722 CTGGTGGCAGTGTGGGGCCTTGG - Intronic
1046840760 8:118854298-118854320 CTGTTGGGAAGCTGGGGGCTAGG - Intergenic
1047146296 8:122203047-122203069 CTGTTGGGAGATGGGGGGCTAGG + Intergenic
1048410000 8:134162792-134162814 TTGTTAGGACTTAGGGGGCTGGG + Intergenic
1050127925 9:2378842-2378864 TTGTAGGCTCTTTGGGGACTGGG - Intergenic
1051926175 9:22329559-22329581 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1052144920 9:25036904-25036926 CTGTTGTTAATTTGGGGGCCAGG + Intergenic
1054766555 9:69047203-69047225 CGGTTGGCTCTCTTGGGGCTGGG - Intronic
1055130431 9:72768317-72768339 CTGTTGGGGGGTTGGGGGCTAGG + Intronic
1056553827 9:87673063-87673085 CTGTTGGCAGTTTGGGTGACTGG + Intronic
1058523048 9:105831113-105831135 CTGTTGGCAAATTGGGCACTTGG - Intergenic
1058640678 9:107080930-107080952 CTGTAGGCTCTTTGAGGGCAGGG + Intergenic
1059332486 9:113544400-113544422 CTTTTGGCTATTTGGGGGTTGGG + Intronic
1059400190 9:114064692-114064714 CTGATGACAATTTGGGGGCTGGG - Intronic
1059841115 9:118217634-118217656 CTGTTGGGAGGTGGGGGGCTAGG + Intergenic
1060183743 9:121551442-121551464 CTGGGGGACCTTTGGGGGCTGGG - Intergenic
1061448522 9:130655967-130655989 CTGTTGACGGTTTGGGAGCTGGG + Intergenic
1186080065 X:5921575-5921597 CTGTTGGTACCATAGGGGCTGGG - Intronic
1186621195 X:11241780-11241802 CTGCTAGCACTTTGTGGGCTAGG + Intronic
1189243943 X:39548406-39548428 CTGTTGGGGGTTGGGGGGCTGGG + Intergenic
1189319746 X:40080549-40080571 CTGCTGGCCTTTTCGGGGCTGGG - Intronic
1189369848 X:40418988-40419010 ATGTGGCCACTTTGGGGACTGGG + Intergenic
1189372663 X:40441587-40441609 CAGTTTACACTTTGGGGGCAGGG - Intergenic
1189869244 X:45365100-45365122 TTGTTGGAACTTTGTGGGGTTGG + Intergenic
1191210121 X:57875936-57875958 CTGTGGCCTCTCTGGGGGCTGGG - Intergenic
1191871349 X:65748395-65748417 ATGTTGGGACTTTGGGGACTCGG - Intergenic
1193228823 X:79018291-79018313 CTGTAGGGACTTTGGGGGAAAGG + Intergenic
1193453361 X:81699092-81699114 CTGTTGGGGGTTGGGGGGCTAGG - Intergenic
1193807117 X:86008251-86008273 CTGTCGGCAGGTGGGGGGCTGGG + Intronic
1194021539 X:88697256-88697278 CTGTTGGCAGGTTGGGGGCTAGG + Intergenic
1194123193 X:89985704-89985726 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1195350530 X:103991779-103991801 CTGTTGGGGGTTGGGGGGCTAGG + Intergenic
1195592975 X:106653683-106653705 CTGTCGGCATGTTGGGGGCTAGG - Intronic
1196179572 X:112675103-112675125 CTTTGGGGACTTTGGGGACTTGG + Intronic
1196547616 X:116981455-116981477 CTGTTGGCGGATGGGGGGCTAGG + Intergenic
1196561898 X:117159632-117159654 CTGTTGGGAGGTTGGGGGCTAGG + Intergenic
1197906826 X:131434246-131434268 CTGTTGGAAGGTGGGGGGCTAGG + Intergenic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1198632770 X:138659902-138659924 CTGTTGGCAGGTGGGGGGCAAGG + Intronic
1198771219 X:140132124-140132146 CTGTTGGGGGGTTGGGGGCTAGG + Intergenic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1200239771 X:154487272-154487294 CTCTTTGCCCTTTGGGGCCTGGG - Intergenic
1200464132 Y:3494204-3494226 CTGATGGGACCTTGGGAGCTGGG + Intergenic
1200476054 Y:3643150-3643172 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1200737960 Y:6820695-6820717 CTGTTGGAACTTGGGGGCATAGG + Intergenic
1201381571 Y:13385657-13385679 GTCTCAGCACTTTGGGGGCTAGG - Intronic