ID: 1153690789

View in Genome Browser
Species Human (GRCh38)
Location 18:7591486-7591508
Sequence GAATACTTCTGAACTTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153690789 Original CRISPR GAATACTTCTGAACTTGTAG TGG (reversed) Intronic
906876678 1:49546617-49546639 GAATACTTCTGCACTGCTGGTGG - Intronic
908275808 1:62469953-62469975 GAATACTTCTGCACTGTTGGTGG + Intronic
909252115 1:73371431-73371453 GAACTCCTCTGAACTGGTAGTGG - Intergenic
910949207 1:92627637-92627659 GAACACTTCTGCACTGCTAGTGG - Intronic
912879635 1:113397377-113397399 GAATAATTTTGAACTTGTTTGGG + Intronic
913312971 1:117521555-117521577 GAACACTTCTGCACTGCTAGTGG + Intronic
913552503 1:119929312-119929334 GTATACTCCTCAACTGGTAGTGG + Intronic
916256774 1:162796425-162796447 AAATTCTTCTGAACTTGCTGTGG + Intronic
918008070 1:180560709-180560731 AAATACTGCTGAACATTTAGTGG - Intergenic
919993523 1:202726655-202726677 AGAAACCTCTGAACTTGTAGGGG - Exonic
921423678 1:214977800-214977822 ATATAGTTCTCAACTTGTAGGGG + Intergenic
924549428 1:245061440-245061462 GAATACTTATGTACCAGTAGGGG + Intronic
1063169060 10:3489974-3489996 GAATACTTCAGAGCTGGTCGTGG - Intergenic
1063331341 10:5162799-5162821 TAATATATCTGAACTTATAGTGG + Intergenic
1065690168 10:28324747-28324769 GGATACTTGTGAACTTGAATAGG - Intronic
1066700644 10:38124272-38124294 GAAAACAACTGAACTTATAGAGG + Exonic
1069879894 10:71585430-71585452 GAATGCTTCTCAACTGCTAGTGG - Intronic
1071398042 10:85242379-85242401 GAATACTTTTGAACTTTTTGTGG - Intergenic
1073224560 10:101906688-101906710 GAAAAGTTCTTAAATTGTAGGGG + Intronic
1073370282 10:102982029-102982051 GGATATTTCTGAATATGTAGTGG - Intronic
1073497855 10:103910676-103910698 CAATAAATCTTAACTTGTAGGGG + Intronic
1080918764 11:36687728-36687750 GAATACAACTGAACTTGAATAGG + Intergenic
1082153644 11:48774475-48774497 GAATATTTCTGAGCTGATAGAGG - Intergenic
1082153666 11:48774818-48774840 GGATACTTCTGAGCTTTTTGAGG - Intergenic
1082187398 11:49200947-49200969 GATTCATTCTGAACTTGTATCGG - Intronic
1086265071 11:84988267-84988289 GAACACTTCTACACTTCTAGTGG + Intronic
1086678937 11:89644475-89644497 GATTCATTCTGAACTTGTATCGG + Intergenic
1089819870 11:121215078-121215100 GAATACTTCTGCACTGTTAGTGG + Intergenic
1095071628 12:37857926-37857948 GAATACTTCTGAGCTGTTTGAGG - Intergenic
1099146667 12:79054066-79054088 GAATTCTTCTGATGTTATAGTGG + Intronic
1103253045 12:119517388-119517410 GAATATTTATGAACATGTATGGG + Intronic
1115901497 14:38155580-38155602 GTATACTTTTGAATTAGTAGAGG - Intergenic
1116055294 14:39856387-39856409 AAATACTTCAGCACTTTTAGTGG + Intergenic
1116970539 14:51060086-51060108 GAATACTTCAGAATTTATAATGG + Intronic
1125087029 15:35741931-35741953 CAATACTTCTGTACATTTAGAGG + Intergenic
1127345079 15:58086882-58086904 AAATACTTCGAAACTTCTAGGGG - Intronic
1127754666 15:62079997-62080019 TAATACCACTGAACTTATAGTGG + Intergenic
1131076758 15:89500124-89500146 GAAGACTTCTGGACTGGAAGAGG - Intergenic
1131760808 15:95620559-95620581 GAATACTTCGTCACTGGTAGAGG - Intergenic
1137968101 16:52956747-52956769 GAACACTTCTGCACTGCTAGTGG + Intergenic
1143327988 17:6112773-6112795 AAACACTTATGAAATTGTAGAGG + Intronic
1150664990 17:67125960-67125982 GAATCATTCTTAACTTCTAGAGG - Intronic
1153690789 18:7591486-7591508 GAATACTTCTGAACTTGTAGTGG - Intronic
1159491836 18:69146497-69146519 TAATACTTTTGAACATATAGAGG - Intergenic
1164298764 19:23939634-23939656 GAACACTTCTACACTTCTAGTGG - Intronic
1164380210 19:27729306-27729328 GGATATTTCTGAACTTTTTGAGG - Intergenic
1165533748 19:36425673-36425695 GAATTCTTCTTAACTTGAATGGG + Intergenic
1166910946 19:46156421-46156443 CAATACTTTAGAACTTGTTGAGG - Intronic
937663476 2:124457943-124457965 GAACACTTCTGTACTGTTAGTGG + Intronic
939467147 2:142572312-142572334 TAAAAATTTTGAACTTGTAGCGG - Intergenic
939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG + Intronic
939722828 2:145676735-145676757 GAATAATTCTAAAGTTGTGGGGG - Intergenic
940833685 2:158496562-158496584 AAAAACTTCTGAACTTGCACAGG - Intronic
942484167 2:176422058-176422080 GAAGACTTCTGAAGTTGTCCTGG + Intergenic
944421149 2:199531839-199531861 GAACACTTCTGCACTTCTGGTGG + Intergenic
944926345 2:204468595-204468617 GAATATTGCAGAACTTGGAGTGG - Intergenic
945641550 2:212437584-212437606 GAATACTTAAGAGCTTTTAGTGG - Intronic
946678470 2:222187917-222187939 GAATACTTGTGCACTTTTGGTGG - Intergenic
1170478942 20:16745830-16745852 GAATACGTCTGAAAATCTAGAGG + Intergenic
1175230785 20:57471908-57471930 CAGTACTTCTGAACTTGCAGAGG + Intergenic
1184328143 22:43807346-43807368 GATTACTTCAGAACTTGGTGAGG + Intronic
952524123 3:34192148-34192170 AAATACTTATGACCTTGTTGTGG + Intergenic
953848029 3:46444355-46444377 GAAAACTCCTGAAATAGTAGAGG - Intronic
954165431 3:48753547-48753569 GAATACTACTGAAATTGGAAAGG - Intronic
956052836 3:65266917-65266939 GCATTCTTCAGAAATTGTAGTGG - Intergenic
957127463 3:76180145-76180167 GATTAATTCTGAACTTGTTGGGG - Intronic
958609479 3:96406212-96406234 GAATTCTTTTGAACTTCTTGAGG - Intergenic
961030105 3:123595278-123595300 GGATACTTCTGAACTGGAGGTGG + Intergenic
961862906 3:129931814-129931836 GAATACTGCAGAACTAGGAGAGG + Intergenic
966362120 3:179141397-179141419 GAATACTTATACACTGGTAGTGG + Intergenic
966980502 3:185129671-185129693 GAATGCTTCTGCACTGTTAGTGG - Intronic
967049269 3:185767314-185767336 GATTTCTTCTGAACTTGTGTTGG - Intronic
970902349 4:21174419-21174441 GAATAATTATAAATTTGTAGGGG + Intronic
977219116 4:94318096-94318118 GAACACTTGACAACTTGTAGTGG + Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978042126 4:104080106-104080128 TAATACTTTTGAACTTGCATGGG + Intergenic
979611330 4:122691912-122691934 TATTACTTCAGAACTTGTATAGG + Intergenic
983689079 4:170446228-170446250 AGATACTTCTGAACTTTTACAGG - Intergenic
985108958 4:186528479-186528501 GAAATCTCCAGAACTTGTAGGGG - Intronic
986909573 5:12537795-12537817 GAATAATGCTGGCCTTGTAGAGG - Intergenic
987568865 5:19629245-19629267 TGATACTTCTCATCTTGTAGAGG - Intronic
990835924 5:60020027-60020049 GAAAACTCTTGAACATGTAGAGG + Intronic
991470855 5:66967527-66967549 GAAGATTTCTGAACTTTTAATGG + Intronic
992498319 5:77316198-77316220 GTATACTTCTGTTCTTTTAGTGG + Intronic
993263999 5:85698097-85698119 GAACACTTATGAACTGTTAGTGG + Intergenic
995954107 5:117753794-117753816 GAACACTTCTGCACTGCTAGTGG + Intergenic
999619560 5:153458938-153458960 GAATACTTCTGCACACCTAGAGG - Intergenic
1005956848 6:30670205-30670227 GGATCCTTCTTAAGTTGTAGGGG - Intronic
1007202720 6:40123907-40123929 GAATACTTGTACACTTGTGGTGG - Intergenic
1007634527 6:43290595-43290617 GATTTCTTCTGAACTTTTATAGG - Intergenic
1008269909 6:49479511-49479533 GAATGCTTATAAACTTCTAGTGG + Intronic
1010462267 6:76126852-76126874 GGAAACTTCTGCACTTGAAGAGG + Intergenic
1011287605 6:85741685-85741707 GAACACTTCTACACTGGTAGTGG - Intergenic
1011450039 6:87482834-87482856 GGATACTTCTGAACTGGGTGAGG + Intronic
1012961423 6:105625966-105625988 GAACAATTCAGAACTTGGAGAGG + Intergenic
1013968801 6:115989898-115989920 GAATGCTTGTGCACTGGTAGTGG - Intronic
1014862055 6:126481240-126481262 GAATACTTTTGATTGTGTAGTGG + Intergenic
1023269529 7:38446655-38446677 GAAAACTTCTAAACTTCTTGGGG + Intronic
1024007769 7:45239854-45239876 GAACACGTCTTAACTTCTAGAGG + Intergenic
1029015532 7:97312063-97312085 GAATAGTTCTAAATTAGTAGAGG + Intergenic
1033078722 7:138273938-138273960 GAATACTTCTGCACTGCTGGTGG + Intergenic
1033313852 7:140282044-140282066 GAATCCATCTGAATTTATAGAGG - Intergenic
1033707371 7:143902393-143902415 GAATACTTCTGAACAAGTGACGG + Intergenic
1037297883 8:17420438-17420460 GAACACTTCTGCACTGTTAGTGG - Intergenic
1039373983 8:37014860-37014882 GAGTACTTAAGAACTTATAGAGG - Intergenic
1041295189 8:56349617-56349639 GAATACTTATGCACTTTTGGTGG - Intergenic
1041481537 8:58326187-58326209 AAATACTTTTTAAATTGTAGAGG - Intergenic
1041536219 8:58928011-58928033 GAACACTTCTTAACTTGTCCGGG - Intronic
1043660821 8:82738066-82738088 GAACACTTTTGAACTGGAAGAGG + Intergenic
1044131692 8:88531495-88531517 GAAAACTTCTGAGGTTGAAGTGG - Intergenic
1045095391 8:98792329-98792351 GAACACTTCTGCACTGCTAGTGG + Intronic
1045098684 8:98825133-98825155 AAATACTTTTGAACTTGAGGGGG + Intronic
1047956361 8:129979315-129979337 GAATGTTTGTAAACTTGTAGTGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1053602065 9:39620840-39620862 GGATACTTCTGAACTTGACTAGG - Intergenic
1053859723 9:42374604-42374626 GGATACTTCTGAACTTGACTAGG - Intergenic
1053895605 9:42739009-42739031 GAATACTTTTTAATTTATAGAGG - Intergenic
1054251471 9:62721593-62721615 GGATACTTCTGAACTTGACTAGG + Intergenic
1054565582 9:66756111-66756133 GGATACTTCTGAACTTGACTAGG + Intergenic
1058346196 9:103965999-103966021 GAACACTTATGAACTCTTAGTGG - Intergenic
1060785592 9:126449602-126449624 GAATATTTCTGAACCTGGACAGG + Intronic
1188710803 X:33395240-33395262 GAATGCTTCTGCACTGCTAGAGG + Intergenic
1191574262 X:62678363-62678385 GAATATTTCTGAACTTTTTTAGG + Intergenic
1191874862 X:65786371-65786393 GAGTACTTCAAAATTTGTAGTGG + Intergenic
1192443252 X:71190772-71190794 GAAGAATTGTGAACTTGTTGAGG - Intergenic
1194469775 X:94279033-94279055 GAATACTTTTTATCTTGTTGTGG - Intergenic
1194967061 X:100300287-100300309 GACTACTTCTGTAATTGTATAGG + Intronic
1197589335 X:128389316-128389338 GAACACTTCTACACTTGTGGTGG + Intergenic
1198248845 X:134859648-134859670 GAGCACTTCTGAATTTGTATTGG - Intergenic