ID: 1153691748

View in Genome Browser
Species Human (GRCh38)
Location 18:7601116-7601138
Sequence ACATTTGTTCCCCTGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153691748_1153691754 3 Left 1153691748 18:7601116-7601138 CCACCCTACAGGGGAACAAATGT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1153691754 18:7601142-7601164 CCTTTTAGGAGACAGAAAACTGG 0: 1
1: 0
2: 1
3: 29
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153691748 Original CRISPR ACATTTGTTCCCCTGTAGGG TGG (reversed) Intronic
903382755 1:22908334-22908356 ACATTTGTTCCCCACCAGTGTGG - Intronic
904772847 1:32890453-32890475 ACATTTTTTCACCTGTAAAGTGG + Intronic
907355049 1:53865602-53865624 ACATTTGTTCCTTGGTATGGGGG - Intronic
907889074 1:58620675-58620697 CCTCTTGTTCCCCTGGAGGGTGG - Intergenic
910670403 1:89766886-89766908 ACACTTGCTCTTCTGTAGGGTGG + Intronic
912787734 1:112620122-112620144 ACGTCTGTTCCCTTGCAGGGAGG - Intronic
915321787 1:155060520-155060542 ACAGCTGTGCCCCTGTGGGGTGG + Intronic
916211394 1:162362907-162362929 ACATTTCTTTCCCTGTTGAGTGG + Intronic
916508736 1:165452545-165452567 ACATCTGGTCCCCTCTAGAGAGG + Intergenic
920406544 1:205717636-205717658 TCATTTTTTACCTTGTAGGGAGG - Exonic
921269548 1:213455204-213455226 ACATCTGTTTCCCTGCAAGGAGG + Intergenic
923192782 1:231636259-231636281 ACATTTTCTCCTCTGTAGGGTGG + Intronic
1070204879 10:74247891-74247913 ACACTTGTTCTTCTGTAGGTGGG - Intronic
1074611364 10:115025239-115025261 ACATTTGTTCCCCGGCAAGGTGG + Intergenic
1076982649 11:213044-213066 CCATGTGGACCCCTGTAGGGTGG + Intronic
1078604317 11:12761730-12761752 AGATTTGCTCCCCTGAAGGATGG + Intronic
1079929968 11:26546136-26546158 ACAAGTGTTCCTCTGTGGGGTGG - Intronic
1081809007 11:45904960-45904982 ACATTTATTCCCCTACAGGAGGG - Exonic
1087441496 11:98189187-98189209 ACATTTGTTCTCCTGTATTTTGG - Intergenic
1087562304 11:99805578-99805600 ACACTACTTCCCCTGGAGGGTGG - Intronic
1089118544 11:116115140-116115162 ACATTTTTTCCCCTGCCGTGGGG - Intergenic
1091837143 12:3594079-3594101 ACGTTTGCTCCCCAGCAGGGAGG + Intergenic
1094652981 12:32395899-32395921 TCTTTTTTTCCCCTGTAGAGAGG + Intergenic
1097289098 12:57898884-57898906 CCATTTCTTCAGCTGTAGGGGGG - Intergenic
1100107669 12:91196400-91196422 ACTCTTGTTCCTCTGTAGGTAGG + Intergenic
1105656116 13:22440314-22440336 ACATCTGATGCCCGGTAGGGTGG - Intergenic
1113118469 13:106900220-106900242 ACCTGTGTTCCCTTGTAAGGAGG - Intergenic
1114698895 14:24657025-24657047 ACATGTGTTCCCGTGTTTGGAGG + Intergenic
1115792974 14:36900345-36900367 ACATGTGTACTCCTGTATGGAGG + Intronic
1118040498 14:61910891-61910913 TCATTTGATACCCTGCAGGGAGG - Intergenic
1124070792 15:26391370-26391392 ACATTTCTCCCCCTGTGGAGTGG - Intergenic
1125934308 15:43621612-43621634 CCATTTGGTCACCTGTAGGTTGG - Intergenic
1126743223 15:51799238-51799260 GCATTCGTTCCCCTGTGGGATGG + Intronic
1132055288 15:98647609-98647631 ACATTTCCTCCCCCGGAGGGAGG + Intergenic
1133292887 16:4734444-4734466 GGATTGGTTCCCCTGGAGGGCGG - Exonic
1134393073 16:13837765-13837787 ATATTTGTTCCCCTACAGAGAGG - Intergenic
1137951032 16:52783514-52783536 ATATTTTTTCCCCTGTTGTGGGG - Intergenic
1142540467 17:654887-654909 ACATTTGTTCCTTCGTGGGGTGG - Intronic
1146981130 17:37162825-37162847 AGATTTCTTCACCTGCAGGGGGG - Intronic
1150489659 17:65565539-65565561 CCATTTGTTCACCTGTAGACTGG + Intronic
1152289313 17:79429817-79429839 ACATTTGTTCTTCTTTTGGGAGG + Intronic
1153691748 18:7601116-7601138 ACATTTGTTCCCCTGTAGGGTGG - Intronic
1157852932 18:51074549-51074571 ACAATTGTGCCACTGTAGTGGGG + Intronic
1159529083 18:69632538-69632560 AAATTTGTACCCGTGTGGGGAGG - Intronic
1162793655 19:13075757-13075779 CCAGTTGTCCCCCTGTCGGGGGG + Intronic
1166191201 19:41177980-41178002 ACAGTGCTTCCCCTGTAGGAGGG + Intergenic
1166531890 19:43547804-43547826 ACATTTCTTCCCCAAGAGGGAGG - Intronic
1166960189 19:46492473-46492495 TCATTTCATCCCCTGTAAGGAGG + Exonic
925867517 2:8241689-8241711 ACATTTGTTTCCCTGTAGCTGGG - Intergenic
931637115 2:64350933-64350955 AAATTGGTTTCCTTGTAGGGAGG - Intergenic
934722355 2:96589721-96589743 AAATGTGTTCTGCTGTAGGGTGG - Intergenic
935026824 2:99284992-99285014 AAATTTGTTCCCCATAAGGGAGG - Intronic
935933495 2:108155483-108155505 ACATTTTTTTTCCTGTAGGATGG + Intergenic
936961424 2:118078959-118078981 ACATTAGCTTCCCTGTAGGAAGG + Intergenic
941564612 2:167090901-167090923 AAATTTCATCCCCAGTAGGGTGG - Intronic
1169224575 20:3847946-3847968 ACATTTGTTCACATTTATGGAGG - Intronic
1173328656 20:42055910-42055932 TCCTTTGTTCTCTTGTAGGGAGG + Intergenic
1173440992 20:43076146-43076168 AAATTGTTTCCCCTGTTGGGTGG + Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1181022594 22:20111610-20111632 ACATGTGTTCCCCTAAAGGTTGG + Exonic
1182395426 22:30032485-30032507 AAATGTTTTCCCCTGTAAGGTGG - Intergenic
1182952662 22:34391811-34391833 ACCATTTTTCTCCTGTAGGGAGG - Intergenic
951158040 3:19378950-19378972 ACAGTTGTTCCCAAGTAGTGAGG + Intronic
953856249 3:46501395-46501417 ACAGTTGTCCCCATGGAGGGAGG + Intergenic
953926480 3:46985228-46985250 ACATCTGAGGCCCTGTAGGGTGG - Intronic
956470476 3:69561371-69561393 TCAATTGTTCCCATGTAGGATGG - Intergenic
959616480 3:108353945-108353967 ACAACTGTTCCCCTGTTGGTGGG + Intronic
966216999 3:177514296-177514318 ACATTTTTTCTCCTGAATGGGGG - Intergenic
967946390 3:194807489-194807511 ACATTTGTTCTGCTGCAGGAAGG - Intergenic
971364070 4:25962462-25962484 ACAATTGTTCCACTGGATGGAGG + Intergenic
972272355 4:37523505-37523527 AAATTGGTGTCCCTGTAGGGAGG + Intronic
978278201 4:106977765-106977787 AGTTTTGTTCCCTTGTTGGGAGG + Intronic
982339692 4:154284368-154284390 AATTTTGTTTCCCTGTTGGGAGG - Intronic
984209559 4:176829141-176829163 AGATCTATTCCACTGTAGGGTGG + Intergenic
984573890 4:181425120-181425142 ACATTTGCACACCTCTAGGGAGG + Intergenic
986934679 5:12868106-12868128 ACATCTGTTCACCTTTTGGGGGG - Intergenic
988354077 5:30150682-30150704 AAATTTGATCCTCTGTATGGGGG - Intergenic
988699946 5:33663338-33663360 ACGTTTGCTCCCATCTAGGGAGG - Intronic
991209278 5:64085433-64085455 AAATTTGTTTTCCTGTGGGGAGG + Intergenic
995350150 5:111165537-111165559 TCTTGTGTTCCACTGTAGGGTGG + Intergenic
996837785 5:127813080-127813102 ACATTTGTGTCCCTTTAGAGTGG + Intergenic
1003032465 6:2614071-2614093 ACATTTGCTCTCCTGTCAGGGGG + Intergenic
1003906391 6:10703876-10703898 ACATTTATTTCCCTGCATGGTGG + Intronic
1004595639 6:17096888-17096910 ACAATTGTTCCCCTGTTTGTGGG + Intergenic
1007501959 6:42305227-42305249 AGATTTCTACCCCTGTAAGGAGG - Intronic
1007774044 6:44214540-44214562 ATAATTGCTCCCCTGCAGGGTGG + Intergenic
1008280755 6:49592850-49592872 AGGTTTGTTGCCCTGTATGGTGG - Intergenic
1011191023 6:84728415-84728437 ACATTTTTTTCTCTCTAGGGAGG - Intronic
1016494317 6:144642711-144642733 ATTTTTTTTCCCCAGTAGGGCGG + Intronic
1018055653 6:160050049-160050071 GCATTTGGTTCCCTGTAGGGAGG + Intronic
1023348606 7:39296701-39296723 ACATCTGTTCCCCTCTGGGGTGG - Intronic
1023970287 7:44986093-44986115 GCATTTGTTCCCTTCTAGGTGGG - Intergenic
1024446995 7:49492306-49492328 AAATTTCTTCCCCAGTAGTGGGG - Intergenic
1028529958 7:91827781-91827803 ACTTTTGTACTCTTGTAGGGAGG - Intronic
1035602310 8:903916-903938 CCCTCTGTTCCCCTGGAGGGCGG + Intergenic
1037172287 8:15907325-15907347 ACATTTGCACCAGTGTAGGGAGG + Intergenic
1038692439 8:29775445-29775467 GCATTTCTTCCCATGTAGTGTGG - Intergenic
1050587740 9:7130655-7130677 ACAACTGTTGCCCTGGAGGGGGG + Intergenic
1052039060 9:23717397-23717419 ACATTTATCCCCCTTTAGTGAGG - Intronic
1054893510 9:70280037-70280059 ACATTTTTTTCCCTGTCTGGTGG - Intronic
1059003855 9:110380420-110380442 AAATTTTTTCCCCTCTAAGGTGG + Intronic
1059092420 9:111374034-111374056 GCTTTTGTAACCCTGTAGGGTGG - Exonic
1188492866 X:30754829-30754851 ACATTTCTCCCCCTTTAAGGTGG - Intergenic