ID: 1153693533

View in Genome Browser
Species Human (GRCh38)
Location 18:7616980-7617002
Sequence ATCAAACAGAAGTACAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 533}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153693533 Original CRISPR ATCAAACAGAAGTACAGAGA GGG Intronic
901148040 1:7081371-7081393 ATCACAAAGAAGGACAAAGAAGG + Intronic
901268592 1:7932595-7932617 ATCAACCAGAGGGACATAGAGGG + Intronic
901550274 1:9990833-9990855 ACCAAACAGAAGGAAAGAAAGGG + Intergenic
902039546 1:13482932-13482954 ACCAAACTGAAGCACAGAGAGGG + Intronic
903493910 1:23751500-23751522 AAGAAAGAGAAGGACAGAGAGGG + Exonic
903961543 1:27060896-27060918 AACAAACAGAGGTAGAGAGTGGG - Intergenic
904915082 1:33964375-33964397 TTCAAAGAGAATTACAGATATGG - Intronic
905011312 1:34748824-34748846 ATCAATAAGAAGGGCAGAGAAGG - Intronic
905774807 1:40661730-40661752 AGGACACAGAAGTTCAGAGACGG + Intronic
905851217 1:41276495-41276517 AGGAAACAGAGGCACAGAGAGGG - Intergenic
906037982 1:42764782-42764804 AAGAAACTGAGGTACAGAGATGG - Intronic
906235054 1:44201519-44201541 AACAAACAAAAGCACTGAGATGG - Intergenic
906299786 1:44673736-44673758 AGGAAACTGAAGTTCAGAGAAGG + Intronic
906658759 1:47567697-47567719 AAGAAACAGAGGCACAGAGAGGG + Intergenic
906764989 1:48420993-48421015 ATATAACAGAAGTAGAGAGCAGG + Intronic
906767214 1:48444599-48444621 ACCAAACAGAAGGACATAGGCGG + Intronic
906776538 1:48534889-48534911 AAGAAATAGAAGTCCAGAGAAGG - Exonic
907119724 1:51997885-51997907 AAGAAACTGAAGCACAGAGAAGG - Intergenic
907880959 1:58548885-58548907 ATCACTAAGAAGTTCAGAGAAGG - Intergenic
907912687 1:58840679-58840701 AGGAAACTGAAGTTCAGAGAAGG - Intergenic
908150212 1:61292973-61292995 ATCAGACAGAAATACAGAGAAGG - Intronic
909060590 1:70874705-70874727 AACAAACAGAAGTATAGAAAGGG - Intronic
909248139 1:73315596-73315618 ATCACACTGAAGTAAATAGAAGG + Intergenic
909257498 1:73442883-73442905 ATGAATAAGAAGTATAGAGATGG - Intergenic
909833161 1:80219719-80219741 ATGAAATAGAAGTATAGAAATGG - Intergenic
910038813 1:82822457-82822479 ATGAAACAGAAGCAAAGGGAAGG - Intergenic
910850400 1:91644611-91644633 ATCAAACAAAAGCACTGAGAAGG - Intergenic
911108626 1:94159878-94159900 ATCAAAAAGAAGTTAAAAGACGG - Intronic
911125396 1:94336806-94336828 AGAAAACTGAAGCACAGAGAGGG + Intergenic
912525754 1:110281420-110281442 TTCAGACATAAATACAGAGATGG + Intronic
912711839 1:111955492-111955514 ATCCAGCAGAAGCACAGAGGAGG - Intronic
913692448 1:121292106-121292128 AACAAACAGAACTAAAGACAAGG - Intronic
913751843 1:122026800-122026822 ATCACAAAGAAGTTCTGAGAAGG - Intergenic
913752312 1:122032396-122032418 ATCACAAAGAAGTTCTGAGAAGG - Intergenic
913754114 1:122053271-122053293 ATCACAAAGAAGTTCTGAGAAGG - Intergenic
913762776 1:122153573-122153595 ATCACAAAGAAGTTCTGAGAAGG - Intergenic
913769562 1:122233804-122233826 ATCACAAAGAAGTTCTGAGAAGG - Intergenic
914145109 1:144987996-144988018 AACAAACAGAACTAAAGACAAGG + Intronic
914250389 1:145917598-145917620 ATGAGAAAGAAGAACAGAGAGGG + Intronic
914729733 1:150359849-150359871 ATCAAAAAAAGATACAGAGATGG + Intergenic
914987143 1:152470934-152470956 ATCAATCAGAGGTTCTGAGAAGG - Intergenic
915098297 1:153479642-153479664 ATGAAACAGAGTCACAGAGAGGG - Intergenic
915281341 1:154824358-154824380 GTCCAACATAAGCACAGAGAAGG + Intronic
915318936 1:155045526-155045548 ATCGAGCAGAGTTACAGAGAGGG - Intronic
915694519 1:157725900-157725922 ACCAAGAAGAGGTACAGAGAAGG - Intergenic
915726578 1:158022392-158022414 ATGAAACTGAAGATCAGAGAAGG + Intronic
916247429 1:162703335-162703357 ATCAATGAGGAGTTCAGAGAAGG + Intronic
916441734 1:164833136-164833158 AGCAAAAAAAAGTTCAGAGAAGG + Intronic
917179581 1:172281186-172281208 AACTGACAGAAGTATAGAGAAGG + Intronic
917546452 1:175973827-175973849 AACAAACAGAAGTGCAGGAAAGG + Intronic
917841869 1:178986777-178986799 ATCAAAGGGAAGTTCTGAGATGG - Intergenic
917951079 1:180037507-180037529 AGCAAACAAAAATCCAGAGATGG + Intronic
918439512 1:184552568-184552590 ATCAAAGAGATGTACAAAGATGG + Intronic
919052151 1:192524699-192524721 ATCTAACAGAAATACTGAGAAGG + Intergenic
919274336 1:195393164-195393186 CTTAATCAGAATTACAGAGAAGG - Intergenic
920080669 1:203370676-203370698 AGGAAACAGAGGCACAGAGAGGG - Intergenic
920479768 1:206310463-206310485 AACAAACAGAACTAAAGACAAGG - Intronic
920674261 1:208028486-208028508 AGGAAACTGAGGTACAGAGAGGG - Intronic
920718724 1:208367191-208367213 TTTAATCAGAAGTATAGAGAAGG - Intergenic
921219257 1:212961601-212961623 GTCAAAAAGAAGGACAGTGAAGG - Intronic
922173537 1:223177436-223177458 AGGAAACAGAAGCTCAGAGAGGG + Intergenic
922922777 1:229320741-229320763 CTCAAAAAGAAGTATAGAGTTGG - Intergenic
923096864 1:230782324-230782346 AACAAACAGAAGTTCTGAAAGGG + Intronic
923344388 1:233036870-233036892 ATTAAACAGCAGTCGAGAGAAGG - Intronic
923437492 1:233981359-233981381 AAATAACAGAAGTATAGAGATGG - Intronic
923453338 1:234140629-234140651 ATCACACAAAAGTTCAGAAACGG + Intronic
923546080 1:234924190-234924212 AGAAAAGAGAAGAACAGAGAAGG + Intergenic
923727224 1:236517108-236517130 AACACACAAAAGTAGAGAGATGG - Intergenic
924246042 1:242086193-242086215 GACAAACAGTAGCACAGAGAGGG + Exonic
924548702 1:245054129-245054151 AACAAACAGAAGTAAAGGGGAGG - Intronic
1063007716 10:1989747-1989769 ATCAGACAGGAGTCCAGGGAAGG + Intergenic
1063414519 10:5862728-5862750 ATGAAACAGAAGCTCAGAGAGGG + Intronic
1063491815 10:6471010-6471032 ATGAAACAGGAGGTCAGAGAGGG + Intronic
1063697456 10:8350682-8350704 ATGAAACAGAAGACAAGAGAAGG - Intergenic
1064132066 10:12719037-12719059 ATCAAAAAGAAATAGAGACAAGG + Intronic
1067464039 10:46480820-46480842 ACCAGACAGAAGTACAGATAAGG - Intergenic
1067623156 10:47903831-47903853 ACCAGACAGAAGTACAGATAAGG + Intergenic
1068691000 10:59914030-59914052 AGCAAAAAGACTTACAGAGATGG + Intergenic
1068961093 10:62867384-62867406 ATATCACAGAAGTACAGAGAGGG - Intronic
1069200529 10:65609557-65609579 ATCTCACAGAAGTACAGAGTAGG + Intergenic
1069339592 10:67394670-67394692 TTCAAACAAAAATACAGGGAGGG + Intronic
1069936097 10:71918084-71918106 ATCAGACAGAAGTGCAGGTAAGG + Intergenic
1070484839 10:76920402-76920424 AGGAAACTGAAGCACAGAGAAGG + Intronic
1070545455 10:77448645-77448667 ATAATACAGAAGTACACGGAGGG - Intronic
1070591681 10:77806266-77806288 ACCACACAGAAGTCCAGACAGGG + Intronic
1071393085 10:85195082-85195104 ATCAAACAGAGGAAGAGAGATGG - Intergenic
1071511251 10:86263942-86263964 AGCAAACAGAAAGCCAGAGAGGG + Intronic
1071676964 10:87663651-87663673 CTGAAACAGAAGTACGGAGGGGG - Intronic
1071731679 10:88254494-88254516 ATGAAGCAGATGTGCAGAGAAGG + Intergenic
1071780392 10:88838426-88838448 AGCAAATAGAAACACAGAGAAGG + Intronic
1072766180 10:98096839-98096861 ATCTGACAGCAGAACAGAGAAGG + Intergenic
1072831142 10:98660136-98660158 ATCAAACAGAAGTACACATGAGG + Intronic
1073053917 10:100687038-100687060 AACAAACTGAGGTCCAGAGATGG - Intergenic
1073853223 10:107645194-107645216 GGGAAACAGAAGTCCAGAGAAGG - Intergenic
1074311501 10:112326897-112326919 AACAAAGAGAACTAAAGAGAGGG + Intergenic
1074924380 10:118052537-118052559 ATCAGGTAAAAGTACAGAGAGGG + Intergenic
1078298688 11:10102293-10102315 ATCAGACAGAAGTGCAGATGAGG - Intronic
1078814394 11:14804965-14804987 CCCAAACTGAAGCACAGAGAAGG + Intronic
1078995279 11:16691484-16691506 ATAAAACAGAAGTGTAAAGAAGG + Intronic
1079252788 11:18799322-18799344 AGGAAACTGAAGCACAGAGAGGG + Intergenic
1079387659 11:19995138-19995160 AACAAATAGAGGTGCAGAGAGGG - Intronic
1079502834 11:21121156-21121178 ATAGAGCAGAAGAACAGAGAGGG + Intronic
1079635891 11:22739848-22739870 GTGATACAGAAGTAAAGAGACGG + Intronic
1080660375 11:34291413-34291435 ATCACAGAGTAGAACAGAGATGG + Intronic
1080710936 11:34747572-34747594 AGGAAACTGAAGCACAGAGAAGG + Intergenic
1081658657 11:44874489-44874511 AGCAAACTGAGGCACAGAGAAGG + Intronic
1081819550 11:45978324-45978346 AACAAACAAAAAAACAGAGATGG + Intronic
1082738682 11:56886022-56886044 AAGAAACTGAAGTTCAGAGAGGG + Intergenic
1083063020 11:59894393-59894415 ATCACACAGAAGCAGGGAGAGGG - Intergenic
1083315306 11:61811269-61811291 GCGAAACAGAAGAACAGAGAAGG - Intronic
1085184536 11:74564305-74564327 AGAAAACTGAAGTTCAGAGAGGG + Intronic
1085756988 11:79209879-79209901 ATCAAACTGCAATGCAGAGAAGG - Intronic
1086148641 11:83583373-83583395 CTCAACCAAAAGTACAGTGAAGG - Intronic
1086903095 11:92389726-92389748 ATAAAATAGAGGCACAGAGAAGG + Intronic
1087016771 11:93561622-93561644 ATGAAACAGATGCCCAGAGAGGG - Intergenic
1089443046 11:118531929-118531951 CCCAAACAGAAGTGCAGACAGGG - Intronic
1089783189 11:120888949-120888971 ATCAAAAACAAGTCCAGGGAAGG - Intronic
1090627641 11:128620063-128620085 ATCACCCAGAAGGACAGAGGCGG + Intergenic
1091410319 12:234931-234953 AACAAACAGATGTCTAGAGAAGG + Intronic
1091810197 12:3390587-3390609 AAGAAACAGAAGCTCAGAGAAGG + Intronic
1093626592 12:21356156-21356178 GTGAAACTGAGGTACAGAGACGG - Intronic
1093901874 12:24644798-24644820 AGCAACCAGAAGTAGAGAAAAGG + Intergenic
1093905754 12:24690213-24690235 ATCAAACTGAAGGAAAGAGGTGG + Intergenic
1094091372 12:26653900-26653922 AAAAAACAAAACTACAGAGAAGG - Intronic
1094594245 12:31849437-31849459 AGCAGACAGAAGTGCAGATAAGG - Intergenic
1094681467 12:32671095-32671117 AAAAAACAGAAAAACAGAGAAGG + Intergenic
1095799295 12:46255738-46255760 AGCACACAGAAGTGCAGATAAGG + Intronic
1096248298 12:50009334-50009356 ATCAAAAAGGAGGAAAGAGAAGG + Intronic
1096624637 12:52886970-52886992 AGCAAACTGAAGTTCAGAGCAGG + Intergenic
1097311705 12:58126231-58126253 ATAATACAGAAGTATATAGAGGG + Intergenic
1098549986 12:71752479-71752501 ATCAAAAAGAAGAAAGGAGAAGG + Intergenic
1098916610 12:76263341-76263363 TTCACACAAAAGTACAGAGTAGG + Intergenic
1099209810 12:79770523-79770545 AACAAATAGAGGTACAGAGTAGG - Intergenic
1099419963 12:82444855-82444877 ATAGACCAAAAGTACAGAGATGG + Intronic
1099586651 12:84525669-84525691 TTAAAACAGAATTACAAAGAGGG - Intergenic
1100274512 12:93059492-93059514 ATGAAACTGAGGCACAGAGAGGG - Intergenic
1100692372 12:97052051-97052073 CTCAAACAGAAAGAGAGAGATGG + Intergenic
1100998654 12:100331599-100331621 TTCAAACAGAATTAGAGACAGGG - Intronic
1101685866 12:107019972-107019994 ATCAAACAGATTTAGAGATAGGG + Intronic
1102772722 12:115492623-115492645 ATTTAACAGAAGTTGAGAGATGG + Intergenic
1103514199 12:121496355-121496377 ATCATACAGAAGCACTGAGCAGG + Intronic
1103742389 12:123099620-123099642 AAAAAACAGTAGCACAGAGAAGG - Intronic
1103775394 12:123363814-123363836 ACCAAACAGAAGCACAAAGCAGG + Intronic
1103938521 12:124489392-124489414 AGAAAACAGAGGCACAGAGAGGG + Intronic
1104041783 12:125135421-125135443 AGAAACCAGAAGCACAGAGAGGG + Intronic
1104196980 12:126549837-126549859 TTCAAACAGAAGTGCAGACCTGG + Intergenic
1106052219 13:26202170-26202192 AAGAAACAGAAATAGAGAGATGG - Intronic
1106442067 13:29784280-29784302 ATAAAATATAATTACAGAGATGG + Intronic
1106466900 13:30021463-30021485 GAAAAACAGAAGTACAGATATGG + Intergenic
1106589915 13:31090243-31090265 AGCAAACAGAGGCATAGAGAAGG + Intergenic
1106726281 13:32489556-32489578 ATCACACTGAAGTAATGAGAAGG - Intronic
1107345232 13:39453098-39453120 ACCAGACAGAAGAACACAGAAGG + Intronic
1107603367 13:42035769-42035791 AGCAAAGAGAAGTAAAAAGATGG + Intergenic
1107843551 13:44486116-44486138 GACAAACAGAAGAACAGGGATGG + Intronic
1107971011 13:45642149-45642171 AGCAGACAGAAGTGCAGATAAGG - Intergenic
1108254623 13:48598419-48598441 GACAAACAGAAGAGCAGAGAAGG + Intergenic
1109367316 13:61372398-61372420 GTCAAAAAGGGGTACAGAGAGGG + Intergenic
1109609218 13:64741193-64741215 ACCAGACAGAAGTGCAGATAAGG - Intergenic
1110130832 13:72007895-72007917 ATTAAACTGAAGCACACAGAAGG + Intergenic
1110155827 13:72314715-72314737 ATCAAACACAATCACAGAGTTGG - Intergenic
1110161577 13:72384714-72384736 ACAAAATAAAAGTACAGAGAAGG - Intergenic
1111121660 13:83859520-83859542 ATTAAAAACAAGTCCAGAGAGGG - Intergenic
1111845568 13:93504405-93504427 ATCATACAGAAGTGGGGAGAAGG - Intronic
1112142021 13:96654650-96654672 ATCAAACACAAGAACAAAGCTGG - Intronic
1112205755 13:97321881-97321903 ATGAAACAGAGGCACAGAGAGGG - Intronic
1112591082 13:100763488-100763510 ATCAAAAATAAGTACATAGGAGG + Intergenic
1113276009 13:108730854-108730876 ATAAAATAAAAGTACAGAGAAGG - Intronic
1115490517 14:33953537-33953559 TTCAAGCAGAAGTAGAGAGGAGG - Intronic
1116455003 14:45109840-45109862 ATTCAACAGAAGTACAAAAAAGG - Intronic
1117808661 14:59521633-59521655 AACATAGAGAAATACAGAGAAGG - Exonic
1118088956 14:62451088-62451110 AGCAAACAGAAGTGCAGAAGTGG + Intergenic
1118117142 14:62792363-62792385 ATTAAGCAGAAGTAAAGAGAAGG + Intronic
1118687933 14:68310387-68310409 AAAAAACACAAGCACAGAGAAGG - Intronic
1120802668 14:88709983-88710005 GTCAACAAGAAGTACAGAGGGGG + Intronic
1121003903 14:90474349-90474371 ACCAGACAGAAGTGCAGATAAGG - Intergenic
1121610985 14:95279438-95279460 ACCAGACAGAAGTGCAGATAAGG - Intronic
1124945563 15:34262477-34262499 ACCAAACACAGGTACAAAGAAGG + Intronic
1125870749 15:43099830-43099852 ATAAAACAGGAGTATAGAAAGGG + Intronic
1125971288 15:43913738-43913760 AGGAAATAGAAGTCCAGAGATGG + Intronic
1126072666 15:44879257-44879279 ATCAGACAGAAATGCAGATAAGG + Intergenic
1126118832 15:45233146-45233168 AGCTAACACAAGAACAGAGAAGG + Intergenic
1126921985 15:53536971-53536993 ATTAAACAGAGGTAAATAGAAGG + Intronic
1127318775 15:57821916-57821938 AAGAAACTGAGGTACAGAGAGGG + Intergenic
1128107151 15:65053603-65053625 ATCCAACAGTAGTCCTGAGACGG + Exonic
1128130348 15:65223193-65223215 AGGAAACTGAAGTCCAGAGAGGG - Intergenic
1128544087 15:68555772-68555794 ATCAAACAGCATCAGAGAGAGGG - Intergenic
1130071715 15:80652061-80652083 CTAGAACTGAAGTACAGAGAGGG - Intergenic
1130444726 15:83990159-83990181 TTCAAACTGAAGTCCAGAGAGGG + Intronic
1130679754 15:85986160-85986182 ATGAATGAGAAGTACAGAGAGGG + Intergenic
1130828580 15:87576241-87576263 AACAAACACAACTACAGTGACGG + Intergenic
1131097884 15:89667340-89667362 AAGAAACAGAGGTTCAGAGAGGG - Intronic
1133304113 16:4799308-4799330 AGGAAACAGAGGTCCAGAGAGGG + Intronic
1133829158 16:9305689-9305711 AGTAAACAGAAGCACAGACAAGG - Intergenic
1136414050 16:30092762-30092784 AGCAGCCAGAAGTACAAAGAGGG - Exonic
1137541193 16:49362991-49363013 ATGAAATTGAAGCACAGAGATGG - Intergenic
1137572163 16:49573857-49573879 AGCAAAGAGAAGCCCAGAGAGGG - Intronic
1137873592 16:51974096-51974118 AATAAACAGAAGTACAGAGAGGG - Intergenic
1138143329 16:54586925-54586947 AGAAAACAGAGGTTCAGAGAAGG + Intergenic
1138386763 16:56640756-56640778 AGCAAGCTGGAGTACAGAGAAGG + Intronic
1138555183 16:57766733-57766755 AGGAAACAGAGGCACAGAGAAGG - Intronic
1138939936 16:61777933-61777955 AGCAAAGAGAAATACAGTGAAGG - Intronic
1139205002 16:65020097-65020119 ATCAGATAGAAGTACAAATAAGG + Intronic
1139616391 16:68096594-68096616 ATATAACAGAGGTACGGAGAAGG + Intronic
1140716000 16:77726212-77726234 AAAAGACTGAAGTACAGAGAGGG - Intronic
1141359475 16:83382115-83382137 AAGAAACAGAAGTTCTGAGAAGG - Intronic
1142178273 16:88655033-88655055 ATGAAACAGAAGAACCCAGATGG + Intronic
1142386963 16:89771580-89771602 GTCAAACAGAAATTGAGAGAAGG + Intronic
1143442696 17:6987692-6987714 AACAAACAGAAGGCCAGAGCTGG - Intronic
1143589602 17:7874292-7874314 TTCAAAAGGAAGTCCAGAGATGG + Intronic
1143913780 17:10274108-10274130 ATGTAACCGAAGTGCAGAGAGGG - Intergenic
1145258824 17:21342745-21342767 AGAAAACAGAAGCACAGAGAGGG + Intergenic
1145317800 17:21745259-21745281 AGAAAACAGAAGCACAGAGAGGG - Intergenic
1145643159 17:26042220-26042242 ATCACAGAGAAGTTCTGAGAAGG - Intergenic
1145908632 17:28529842-28529864 ATCAGCCAGGAGTGCAGAGAAGG + Intronic
1146567252 17:33924046-33924068 AGGAAACAGAAATAAAGAGAGGG - Intronic
1146859586 17:36285426-36285448 AACAAACAGAAGTCTTGAGATGG + Intronic
1147089910 17:38089513-38089535 AACAAACAGAAGTCTTGAGATGG + Intergenic
1147107301 17:38231008-38231030 AACAAACAGAAGTCTTGAGATGG - Intergenic
1147980157 17:44269147-44269169 AGAAAACAGAAGCCCAGAGAGGG - Intergenic
1148422226 17:47557528-47557550 AACAAACAGAAGTCTTGAGATGG + Intronic
1149142261 17:53445973-53445995 ATCAGACAGTTGTAAAGAGAGGG + Intergenic
1149200737 17:54183143-54183165 AGCAGACAGACCTACAGAGATGG - Intergenic
1150156367 17:62857102-62857124 AAGAAAATGAAGTACAGAGAGGG + Intergenic
1150378557 17:64702385-64702407 ATAAGACAGAGATACAGAGATGG - Intergenic
1150593459 17:66582990-66583012 AGAAAACTGAAGAACAGAGAGGG - Intronic
1153693533 18:7616980-7617002 ATCAAACAGAAGTACAGAGAGGG + Intronic
1154951577 18:21215431-21215453 ATGTAACAGAAATTCAGAGAGGG - Intergenic
1156947994 18:42858280-42858302 TTCATACAGAAGTGCAGAGATGG - Intronic
1156985849 18:43350740-43350762 AGCAAGAAGAAGTAAAGAGAAGG - Intergenic
1157171538 18:45411433-45411455 ATACAACAGAAGCACAGTGAAGG + Intronic
1157547233 18:48555070-48555092 ATAAAAGAGATGTACAGAGAAGG - Intronic
1157680782 18:49603886-49603908 ATGAAAGAGAGGTACAGAAATGG + Intergenic
1158169694 18:54583476-54583498 GTGTAACAGGAGTACAGAGAAGG + Intergenic
1159491292 18:69138501-69138523 ATAAAACAGGATTACAGCGATGG + Intergenic
1159902785 18:74063665-74063687 CTCAAACAGACGCACAGAGAAGG - Intergenic
1160323356 18:77917028-77917050 AGCAAACAGAAGTCTAGAAATGG + Intergenic
1160374594 18:78401933-78401955 CACAGACAGAAGTAGAGAGATGG - Intergenic
1160572076 18:79824481-79824503 ATCAATCAGAAGCATAGAGCAGG - Intergenic
1161075877 19:2285518-2285540 AACAAACCGAGGCACAGAGAGGG + Intronic
1163554153 19:17983126-17983148 ATCAACCCGATTTACAGAGAGGG + Intronic
1163652478 19:18526269-18526291 AGCAAACTGAGGAACAGAGATGG - Intergenic
1164145861 19:22512295-22512317 ATCACACAGCAGGACAGTGATGG + Intronic
1164579731 19:29427369-29427391 AGAAAACAGAAGCACAGAGAAGG + Intergenic
1164627362 19:29738308-29738330 AAAAAACAGAAGCTCAGAGAGGG + Intergenic
1165499129 19:36173716-36173738 ATCCAACAGAATTCCATAGAAGG + Intergenic
1166346632 19:42170319-42170341 CTCAAACAGATGCACAAAGACGG + Intronic
1167553998 19:50181498-50181520 AGGAAACAAAAGTACAGTGAAGG - Intergenic
1167569558 19:50278346-50278368 ACCAAATAGAAGCCCAGAGAGGG - Intronic
1167787474 19:51647523-51647545 AGCAAACTGAGGCACAGAGAGGG - Intergenic
1168711006 19:58499881-58499903 ATGAGAGAGAAGTATAGAGAAGG + Intronic
924998628 2:386427-386449 ATAAAACTGAAGTTCAGAAAAGG - Intergenic
925335123 2:3092545-3092567 CTCAAAAAGAAGTACAAAGTGGG + Intergenic
925542828 2:4984958-4984980 AAAATCCAGAAGTACAGAGACGG + Intergenic
926707175 2:15845153-15845175 AGCAAACAGAGGCACAGAGAGGG - Intergenic
926751712 2:16203511-16203533 ACCATACAGAAAGACAGAGATGG - Intergenic
927216995 2:20672981-20673003 ATCACACAGATGCACCGAGAGGG - Exonic
927455356 2:23244118-23244140 ATCAAACAGACCTAAAAAGAAGG + Intergenic
928001110 2:27523707-27523729 ATCAAACAGTAGATCAGAGGTGG + Intergenic
928382399 2:30830046-30830068 ACCAGACAGAAGTACAGATAAGG - Intergenic
928882353 2:36111993-36112015 AGCAAAGGCAAGTACAGAGATGG + Intergenic
929798779 2:45082105-45082127 ATCAAACGAAATAACAGAGATGG - Intergenic
930241640 2:48941661-48941683 ATGAAATGGAAGTCCAGAGAAGG - Intergenic
930878815 2:56249077-56249099 ATTAGACAGAAGAAGAGAGAAGG - Intronic
931128695 2:59306955-59306977 ATGTTACAGAAGTTCAGAGATGG - Intergenic
931153383 2:59599912-59599934 ATAAAACAGAAGCCCAGAAATGG - Intergenic
931220512 2:60284617-60284639 ATCAAACAGACGTAGAAAGTGGG + Intergenic
931390598 2:61840080-61840102 AGCAAAAAGAAGAACGGAGAAGG - Exonic
931581952 2:63785593-63785615 AATAAAGAGAAGAACAGAGAGGG - Intronic
931723314 2:65083322-65083344 GTCAAACAGAATGACAGAAAAGG + Intronic
931898130 2:66756554-66756576 AGCAAACAGAAACTCAGAGAAGG + Intergenic
932754065 2:74392761-74392783 AGAAAACAGAGGCACAGAGAGGG - Intergenic
933009484 2:77041113-77041135 ATCTAACAGAAGTAGAAAGCAGG - Intronic
933083966 2:78031431-78031453 ATAAAACAGAAGGGAAGAGAAGG + Intergenic
933569580 2:83993765-83993787 AGAAAAGAGAAGAACAGAGAAGG + Intergenic
933765900 2:85709442-85709464 ATGACACAGAAGTAGAAAGAAGG + Intergenic
933993160 2:87648266-87648288 ATCACACAGAAGCCTAGAGACGG + Intergenic
934038079 2:88105259-88105281 AGAAAACTGAAGCACAGAGAGGG - Intronic
934104579 2:88683825-88683847 ACCAGACAGAAGTCCAGATAAGG - Intergenic
934161729 2:89256076-89256098 TTCAAACAGAACAACAGTGAAGG + Intergenic
934205555 2:89926339-89926361 TTCAAACAGAACAACAGTGAAGG - Intergenic
935573021 2:104681935-104681957 ATCCTGCAGAAGCACAGAGAGGG + Intergenic
936743775 2:115548453-115548475 AGGACACAGAAGTACAGACAAGG + Intronic
936848071 2:116861979-116862001 ATTAAACAGAATTATTGAGATGG - Intergenic
936998324 2:118438399-118438421 ATCAAACAATAGTATATAGATGG - Intergenic
937363971 2:121247401-121247423 ACCTACCAGAAGTACAGAAATGG - Intronic
937632271 2:124116415-124116437 ATCAAAGAGAAGGGAAGAGATGG + Intronic
939171488 2:138701356-138701378 AGCAAACAGAAAAACAGAGCGGG + Intronic
939750852 2:146044434-146044456 AACAAACAAAAGTATTGAGAGGG + Intergenic
940134315 2:150418834-150418856 ATCAAAGAAAAGAACATAGATGG + Intergenic
940400541 2:153243416-153243438 ATCAGACAGAAGTGTAGATAAGG - Intergenic
940440593 2:153711511-153711533 ATTAAATGGAAGTTCAGAGAAGG + Intergenic
941414702 2:165205586-165205608 TACAAACAGCAGAACAGAGATGG - Intergenic
941877658 2:170451291-170451313 ACCAGACAGAAGTACAAATAAGG + Intronic
942166280 2:173243946-173243968 ATCTTTCAGAAGCACAGAGAAGG + Intronic
942948945 2:181700841-181700863 AAGAAACAGAAGTAGAAAGAAGG - Intergenic
942996468 2:182266906-182266928 ATCAGAAACAAGTCCAGAGATGG - Intronic
946098459 2:217296980-217297002 TCCAAACTGAGGTACAGAGAGGG + Intronic
946960613 2:224981565-224981587 ATCAAACAGATGCACAAAAAAGG + Intronic
947063395 2:226192091-226192113 ATTGATCTGAAGTACAGAGAAGG + Intergenic
947094131 2:226546482-226546504 ATTAAACAGGAACACAGAGAAGG + Intergenic
1168751333 20:284011-284033 ATCCAAGAGAACTACATAGAAGG - Exonic
1168881234 20:1207819-1207841 TCCAAAGAGAAGTAGAGAGAGGG + Exonic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170506414 20:17030304-17030326 AACAAACTGAAGACCAGAGAAGG + Intergenic
1172156814 20:32831975-32831997 ATCCAACAAAAGTACACTGAGGG - Intronic
1172597673 20:36161300-36161322 GACAAACTGAGGTACAGAGAAGG - Intronic
1172672414 20:36643619-36643641 ATGAGACTGAAGAACAGAGAGGG - Intronic
1172940934 20:38654153-38654175 AGCAAACAAAGGGACAGAGAGGG - Intergenic
1173646890 20:44638979-44639001 ATTAAATAGAGGTTCAGAGAAGG + Intronic
1174916503 20:54659587-54659609 ATAAAACACAAGTTCAAAGAAGG - Intergenic
1175090095 20:56495542-56495564 ATGAAACCCAAGTACAAAGATGG - Intronic
1175630813 20:60534959-60534981 ATGAAACAAATGTGCAGAGAAGG + Intergenic
1176551617 21:8225183-8225205 AGCAAAAAGAAGAAAAGAGAAGG - Intergenic
1176570526 21:8408182-8408204 AGCAAAAAGAAGAAAAGAGAAGG - Intergenic
1176578435 21:8452357-8452379 AGCAAAAAGAAGAAAAGAGAAGG - Intergenic
1177752631 21:25304369-25304391 CTCAAAGAAAAATACAGAGAAGG + Intergenic
1177986959 21:27988434-27988456 ATCTAGCTGAAGTACAGAGAAGG + Intergenic
1178209877 21:30517416-30517438 ATGAAACATCACTACAGAGATGG + Intergenic
1178540083 21:33442158-33442180 ATCAAACAGAAGGACAGCTGGGG - Intronic
1178591447 21:33914378-33914400 GTCAAACAGCAGTACAGTCAGGG - Intronic
1180896852 22:19341676-19341698 AGCAAACAAAAATACAGAGTGGG + Intronic
1181118352 22:20648441-20648463 CTCAACCAGAAGGTCAGAGAAGG + Intergenic
1181858711 22:25801618-25801640 AGCAAACAGAGGCTCAGAGAAGG + Intronic
1182064780 22:27422890-27422912 AGCAGACAGAAGCCCAGAGATGG - Intergenic
1182070603 22:27461071-27461093 AGAAAATAGAAGTCCAGAGAGGG - Intergenic
1182950522 22:34371039-34371061 ATAAAACAGAAGGACATAAAGGG - Intergenic
1183128912 22:35813885-35813907 ATCAAACTGGAGTGCAGGGATGG + Intronic
1183288534 22:36983198-36983220 AACAAACAAAAGTCCAGAGGAGG - Intergenic
1183366132 22:37407985-37408007 ATGAAACAGAGGTCCAGAGAAGG - Intronic
1183429246 22:37755809-37755831 ATCATCCAGAAGTACACTGAGGG + Intronic
1183649219 22:39144760-39144782 AGGAAACTGAAGTTCAGAGAAGG - Intronic
1203256639 22_KI270733v1_random:142105-142127 AGCAAAAAGAAGAAAAGAGAAGG - Intergenic
949113390 3:290518-290540 AGCAAACAGAAATCAAGAGATGG - Intronic
949802667 3:7920705-7920727 ATCAACCTGAAGGAGAGAGAAGG + Intergenic
949849522 3:8408807-8408829 AGGAAACAGAAGTATAGAGAAGG - Intergenic
949857594 3:8476169-8476191 AGAAAACAGAAGGACAGAGTTGG + Intergenic
949902573 3:8830261-8830283 AACAAAAGGAAATACAGAGAAGG + Intronic
949998320 3:9636741-9636763 ATCAGACAGAAGTACAGATAAGG + Intergenic
950457698 3:13102476-13102498 AGCAAACAGAAGCTCAGAGAAGG - Intergenic
950639222 3:14337566-14337588 AGGAAACCGAAGCACAGAGAGGG + Intergenic
951066266 3:18269618-18269640 ACCAGACAGAGATACAGAGATGG + Intronic
951401175 3:22233006-22233028 ATTAAATAGAAGTACAAATAGGG - Intronic
951448894 3:22814237-22814259 AGCAAACAGAAGTACCCACAAGG - Intergenic
951790180 3:26473185-26473207 AACAAACAGAAACACAAAGATGG - Intergenic
952294936 3:32053078-32053100 ACCAGACAGAAGTGCAGATAAGG - Intronic
952777875 3:37064051-37064073 GACAAACAGAAGTACAAAGGAGG + Intronic
953344342 3:42162576-42162598 ACCAAACAGAATTACAGGAAAGG - Intronic
953416291 3:42720422-42720444 AGCAAACAGAAGTGCAGATAAGG - Intronic
954671803 3:52295027-52295049 TACAAACAGAAGTATAGGGAAGG - Intergenic
954961906 3:54573110-54573132 AACAAACAGATGCACAGTGAGGG - Intronic
955370674 3:58348903-58348925 ATTAAAAAAAAGTACAGACAGGG - Intronic
955656523 3:61250837-61250859 AGCAAACCGGAGTATAGAGAAGG - Intronic
956837474 3:73107255-73107277 AAGAAACTGAAGTACAGAGAGGG + Intergenic
956965805 3:74458635-74458657 AAATAACAGAACTACAGAGATGG + Intronic
957737609 3:84223498-84223520 ACCAGACAGAAGTGCAGATAAGG + Intergenic
958020049 3:87983605-87983627 ATAAAACAGCAGGCCAGAGAGGG - Intergenic
958174545 3:89979371-89979393 ATAAAACTGAAATACAGAGTAGG + Intergenic
958752492 3:98208867-98208889 ATCAAACAGAGTAACAGAAATGG + Intergenic
958913591 3:100023080-100023102 ATGAATCAGTAGTAAAGAGATGG + Intronic
958917090 3:100061746-100061768 AGAAAACTGAAGCACAGAGAAGG + Intronic
958968382 3:100584611-100584633 ATCAGACAGAAGTGCAGACAAGG + Intergenic
959508343 3:107179239-107179261 AGGAAAGAGAAGTCCAGAGAAGG + Intergenic
960126434 3:114003872-114003894 TGCAAACATAAGTACAGTGAAGG + Intronic
960506358 3:118499672-118499694 AACAAACATAAGAAAAGAGAGGG - Intergenic
961078668 3:124005370-124005392 CTCAAACAGAAGTACAGCCCTGG + Intergenic
961616336 3:128184604-128184626 AAAATACAGAACTACAGAGATGG - Intronic
961797634 3:129421235-129421257 AGCAAACAGAAGTCTTGAGAGGG - Intronic
961847737 3:129781852-129781874 ATAAAACAGAAGAAAAAAGATGG + Intronic
963371493 3:144406864-144406886 ACCACACCAAAGTACAGAGAAGG - Intergenic
963554016 3:146762589-146762611 ATTAAAAATAAGTACAGTGATGG - Intergenic
963590585 3:147252833-147252855 ATAAAACAGAGGGACAGAGATGG - Intergenic
964520512 3:157562009-157562031 AACAAACAGTAGTGTAGAGAAGG - Intronic
964659822 3:159107733-159107755 AAGAAACTGACGTACAGAGAGGG + Intronic
965089565 3:164145167-164145189 ACCAGACAGAAGTGCAGATAAGG - Intergenic
965471876 3:169103628-169103650 ATGAGACAGCAGGACAGAGATGG + Intronic
965588253 3:170338775-170338797 ACCACACAGAAGTGCAGATAAGG + Intergenic
965751182 3:171976453-171976475 TGCAGACAGAAGTACAGGGAGGG + Intergenic
965869198 3:173246429-173246451 ATCAGACAGAAGTGCAGACAAGG + Intergenic
967041783 3:185700214-185700236 CACACACAGAGGTACAGAGATGG + Intronic
968205258 3:196794164-196794186 ATTAAACAGAAATACAAAGATGG + Intronic
968642880 4:1723071-1723093 ATCAAGCAGAAGTCAAGAGACGG - Intronic
968809633 4:2793995-2794017 AGCAAACTGAGGCACAGAGAGGG - Intronic
969116930 4:4876264-4876286 AGGAAACTGAAGTTCAGAGAAGG + Intergenic
969210096 4:5680835-5680857 ATTAAACTGAAGAACAGAAATGG + Intronic
969814634 4:9678010-9678032 ATCAAACATAAGTGCACAGCCGG + Intergenic
970079623 4:12265664-12265686 ATCAAAGAAAAGAAAAGAGAAGG + Intergenic
971930870 4:33081110-33081132 AAGAAACAGATGTCCAGAGATGG - Intergenic
971933271 4:33113944-33113966 AGCAAACAGCAGCAGAGAGATGG - Intergenic
972571865 4:40318437-40318459 CTGAACCAGAAGTTCAGAGAAGG - Intergenic
973152845 4:46909419-46909441 ATCAAACAAAAGAATTGAGATGG + Intergenic
973834227 4:54793012-54793034 ATGAAACTGAGATACAGAGAGGG + Intergenic
973860834 4:55063061-55063083 ATCAAACAAAAGTAGGGAGAAGG - Intergenic
974431447 4:61802410-61802432 AGCAAGCAGAATTACAGTGATGG - Intronic
975078340 4:70242262-70242284 ATAAAAAAGAAATGCAGAGAAGG - Intergenic
975896906 4:79104249-79104271 ATTAAAAACAACTACAGAGAAGG - Intergenic
976201410 4:82582856-82582878 ATGAAAAAGAAGAACAGAAAAGG - Intergenic
976327904 4:83793663-83793685 ATGAAACAGAAGGAAAGATATGG - Intergenic
977049027 4:92103313-92103335 AACAAACAAAAGAACATAGAGGG + Intergenic
977592969 4:98847673-98847695 ATCAGACAGAAGTGCAGATAAGG + Intergenic
979086705 4:116421066-116421088 ATCAAATAAATATACAGAGATGG + Intergenic
979484650 4:121256742-121256764 CTCAAACAGAAGAAAAGGGATGG - Intergenic
979679367 4:123442869-123442891 TTCAAACAGAATTTAAGAGAAGG - Intergenic
981575267 4:146197621-146197643 ATAAAACAGAAGTAGAAAGAGGG - Intronic
982294624 4:153814506-153814528 AACAAACAAAAGAACACAGAAGG - Intergenic
982469528 4:155771216-155771238 ATTAAACAGTAGTACATGGAAGG - Intronic
982570751 4:157048297-157048319 AAGAAACAGAATTTCAGAGAAGG - Intergenic
983231901 4:165137330-165137352 ATGAGACAGAAATACTGAGAAGG + Intronic
984310988 4:178057855-178057877 ATCAAACAGCACTACAAAGAAGG + Intergenic
984441458 4:179775752-179775774 CCCAGACAGAAGTACAGATAAGG - Intergenic
984760864 4:183361575-183361597 ATCAAACAGAAAAACTGAAAAGG - Intergenic
984765058 4:183394088-183394110 AGGAAACAGAGGCACAGAGAGGG - Intergenic
984839493 4:184054904-184054926 ATCAAACACAAGTTCAGACAAGG - Intergenic
985393664 4:189517822-189517844 AGAACACAGAAGTACAGAAATGG + Intergenic
985901140 5:2794542-2794564 CTCAAAAAAAAGCACAGAGATGG - Intergenic
986663517 5:10080120-10080142 ATCAAAGAGAACAACAAAGATGG - Intergenic
987280618 5:16410343-16410365 ATCAAACTAAGGTTCAGAGAGGG - Intergenic
987352724 5:17035728-17035750 ATGAGATGGAAGTACAGAGAGGG + Intergenic
987542007 5:19268161-19268183 ATAAAACAGTATTACAGGGAGGG + Intergenic
987770295 5:22293793-22293815 ATCTCACAGAAGTAGAGAGTAGG + Intronic
988176645 5:27735116-27735138 AGCAAAGATAAGTAAAGAGATGG + Intergenic
988407957 5:30848963-30848985 AACAAACAGAAGTACAAGGCTGG + Intergenic
988834370 5:35016820-35016842 CTCTTACAGTAGTACAGAGATGG + Intronic
988868162 5:35358272-35358294 AGCATACAGATGTACAGATAAGG - Intergenic
989798602 5:45506474-45506496 AGAAAACAGAGGTACAGACATGG - Intronic
990364188 5:55053081-55053103 ATGAAACTGAAATACAGAAAAGG - Intergenic
991516544 5:67442620-67442642 ATCAAACTGAGGTAGAGAAAGGG - Intergenic
991670553 5:69043205-69043227 ATAAGACGGAAGGACAGAGAAGG - Intergenic
992138791 5:73774320-73774342 ATCAAAGAGAATAACACAGAAGG - Intronic
992170253 5:74094633-74094655 AGGAAACAGATGTCCAGAGAGGG + Intergenic
992265140 5:75011152-75011174 ATGAAACAGAAGTCTAGTGAGGG + Intergenic
992667190 5:79021927-79021949 AGGAAACTGAAGCACAGAGAGGG - Intronic
993018226 5:82561461-82561483 ACCAAACAGAAATATAGAGAAGG - Intergenic
993049137 5:82905686-82905708 ATAAAGGAGAAGTACAAAGAAGG - Intergenic
993219910 5:85080031-85080053 ATCAAAAATAAAAACAGAGAAGG - Intergenic
993466411 5:88252159-88252181 ATCACAGAAAAGTAAAGAGAAGG + Intronic
993601969 5:89937391-89937413 GCCAAACAGAAGTACACAAAAGG - Intergenic
994032451 5:95159783-95159805 ATAAAACAGAAACACAAAGAGGG + Intronic
995245057 5:109925551-109925573 ATCAATCACAAGCACAGAGATGG + Intergenic
995348883 5:111152347-111152369 AGCCAACAGAAATAAAGAGAAGG - Intergenic
997488237 5:134250012-134250034 TTCAAAAAGAAGTGTAGAGAGGG - Intergenic
998150914 5:139757009-139757031 AGGAAACAGAGGCACAGAGAGGG + Intergenic
998260463 5:140627276-140627298 ACCAGACAGAAGTGCAGATAAGG + Intergenic
998731193 5:145079440-145079462 ATCAAAAAGAAGTATAGACAAGG - Intergenic
998955890 5:147437687-147437709 ATCATACAGGAGTGCAAAGAGGG + Intronic
998983398 5:147728922-147728944 ACCAGACAGAAGTGCAGATAAGG - Intronic
999312684 5:150561924-150561946 CTAAAACAGAAGTACAAACAGGG + Intergenic
999669533 5:153946393-153946415 ATCAAACAGATATTCAGAAAGGG + Intergenic
999751369 5:154630421-154630443 AGGAGACAGAAGTCCAGAGACGG + Intergenic
999759618 5:154690496-154690518 AAGAAACAGAAGTACAGAGAGGG + Intergenic
999786686 5:154896845-154896867 AGAAAACAGAAGCACAGAGAAGG + Intronic
1000787065 5:165558625-165558647 TCCAAACAGGAGCACAGAGAGGG - Intergenic
1001227117 5:169954579-169954601 ATAAAATAGAAGAACAGGGATGG - Intronic
1002373687 5:178773869-178773891 AGAAACCAGAAGCACAGAGAGGG - Intergenic
1002722207 5:181268909-181268931 TGCAGACAGAAGTACTGAGATGG + Intergenic
1003374930 6:5568093-5568115 ACCAGACAGAAGCAGAGAGAGGG - Intronic
1003575773 6:7293128-7293150 ACCAAACCTAAGTACAGGGAAGG - Intronic
1004411614 6:15386290-15386312 CCCACACAGAAGTAGAGAGAGGG - Intronic
1004432448 6:15557048-15557070 ACCAGACAGAAGTGCAGACAAGG - Intronic
1004557791 6:16716511-16716533 AACAAACAGAAGATCAGAGAGGG - Intronic
1004754710 6:18599452-18599474 ATAAAACAAAAGTACAGACTCGG - Intergenic
1004987742 6:21101837-21101859 ATTAGATAGGAGTACAGAGAGGG - Intronic
1006206863 6:32353060-32353082 ATAAAGCAAAAGTAAAGAGAAGG + Intronic
1006473971 6:34243643-34243665 ATTTTACAGAAGTCCAGAGAGGG + Intronic
1007407458 6:41643229-41643251 ACCAATCAGCAGTACAGAGGGGG - Intronic
1007771126 6:44193099-44193121 AGTAAACTGAAGTTCAGAGAGGG - Intergenic
1008088557 6:47269687-47269709 ACCAAACAGCAGAACAAAGAGGG + Intronic
1008154647 6:47998831-47998853 CTCTAAAAGAAGAACAGAGAAGG + Intronic
1008301959 6:49851850-49851872 AAGAAACAGAGGTCCAGAGAAGG - Intronic
1009790535 6:68395842-68395864 ATCATTCAGAAGTAGAGTGACGG - Intergenic
1009915505 6:69990529-69990551 AACAAACAAAATGACAGAGAGGG - Intronic
1010480704 6:76349562-76349584 CTCAAAAAGAAGCTCAGAGAGGG - Intergenic
1010987795 6:82445603-82445625 ATCATACATAAGTAAAGAGGAGG - Intergenic
1011334011 6:86240195-86240217 ATTATACAGAGGTACAAAGAGGG + Intergenic
1013109525 6:107053919-107053941 TCCAAAGAGAAGTCCAGAGATGG - Intergenic
1013651451 6:112199222-112199244 ATCACACAGGGGTGCAGAGAAGG - Intronic
1013691058 6:112644128-112644150 ACCAAACAGAACTACATAAACGG - Intergenic
1014163144 6:118193722-118193744 ATCAGACAGAAGTGCAGATAGGG + Intronic
1014264137 6:119255636-119255658 AGGAAACTGAAGTTCAGAGAGGG + Intronic
1014697930 6:124647199-124647221 ATTTAGGAGAAGTACAGAGAAGG + Intronic
1014738601 6:125123327-125123349 ATCAGACGGAAGTGCAGATAAGG - Intronic
1015256027 6:131180313-131180335 AAAACACAGAAGCACAGAGAGGG - Intronic
1015781404 6:136870358-136870380 TTGAAACAGATGTAAAGAGATGG + Intronic
1016402609 6:143696811-143696833 AGCAAACACAAGTGGAGAGAGGG - Intronic
1017058483 6:150459050-150459072 ATAAAACTGAGGCACAGAGAGGG + Intergenic
1017274549 6:152550898-152550920 ATCACACAGAAGTGCAGGGATGG + Intronic
1018055304 6:160047220-160047242 ATCCAACTGAACTACAGAGGCGG + Exonic
1018409157 6:163524439-163524461 ATTAAACAGAAATACTGGGAAGG - Intronic
1018480825 6:164188217-164188239 AACAAACATAAGAGCAGAGATGG - Intergenic
1018598192 6:165507108-165507130 ATGAAACACAAGTACAGGGTAGG - Intronic
1020367988 7:7400736-7400758 GTGAAAAAGAAGTACAGAAATGG - Intronic
1021960871 7:25871808-25871830 ATAAAACAGAACTAAAAAGAAGG + Intergenic
1022250670 7:28604668-28604690 ATCAAGAAGAAATACAGAGAGGG - Intronic
1022495674 7:30851686-30851708 AGGAAACAGAAGCCCAGAGAGGG + Intronic
1022737708 7:33091512-33091534 AGCAAACAGACGTACAGGAAAGG - Intergenic
1022746966 7:33182350-33182372 ACCAGACAGAAGTGCAGATAAGG + Intronic
1023129293 7:36986657-36986679 ATCAAATAAAAGTAGAGAGAGGG - Intronic
1023585220 7:41722893-41722915 AGCAAACAGAAGGTCATAGAGGG - Intergenic
1023587670 7:41748106-41748128 ACCAGACAGAAGTGCAGATAAGG + Intergenic
1023933471 7:44722285-44722307 CTCAGACAGAAGTCCAGATAAGG + Intergenic
1024284723 7:47747253-47747275 CTCAAACAGAGGTTCAGAGTAGG - Intronic
1025908607 7:65809518-65809540 ATGTGACAGAAGTACAGAGTGGG - Intergenic
1027664698 7:81030903-81030925 AAAAAAAAGAAGTACAAAGAAGG - Intergenic
1027724563 7:81788016-81788038 AACAAACAGAAAAACAGAGCCGG - Intergenic
1028166388 7:87542387-87542409 TAGAAACTGAAGTACAGAGAAGG + Intronic
1028389000 7:90293779-90293801 CCCAGACAGAAGTACAGATAAGG + Intronic
1030698518 7:112613173-112613195 CACAAACAGAAGTATAGAGAAGG + Intergenic
1031597559 7:123665627-123665649 AGTAAACCGAGGTACAGAGAGGG + Intergenic
1031882974 7:127217672-127217694 ATCTAACAGACCTGCAGAGATGG - Intronic
1033264135 7:139869896-139869918 ATGAAACAAGAGTGCAGAGAAGG + Intronic
1033938748 7:146623468-146623490 AACAGACAAAACTACAGAGAGGG - Intronic
1034256862 7:149729441-149729463 AAGAAACAGAGGGACAGAGAGGG - Intronic
1034402466 7:150873086-150873108 CTGATACAGAAGTAGAGAGAAGG - Intergenic
1034988337 7:155531644-155531666 AGGAAACAGAAGTACAAATAAGG - Intronic
1035082103 7:156224790-156224812 ATCACAGAGAAGTGAAGAGAAGG - Intergenic
1035828896 8:2673296-2673318 ACCAAACAGAAATAGAGAAAGGG - Intergenic
1036568289 8:9957016-9957038 CTCAATCAGAAGCACAGAGTGGG + Intergenic
1037474572 8:19243916-19243938 ATCAAACAGAAACACGGAAAGGG - Intergenic
1037598540 8:20374385-20374407 AGAAAACAGAGGCACAGAGAAGG + Intergenic
1037927893 8:22858961-22858983 ACAAAACAGAACTACACAGAAGG + Intronic
1037963000 8:23113736-23113758 AACAAACAAAAGAACAAAGATGG - Intronic
1038589357 8:28822185-28822207 AACAAAAAGAAAAACAGAGATGG + Intronic
1039274171 8:35917072-35917094 ATTAAACAGGATTACAGAGATGG - Intergenic
1039702481 8:39976397-39976419 ATCAATGAGAGGTACACAGAGGG + Intronic
1040601452 8:48888402-48888424 AAAAAACAGAAGAACAGAGGTGG - Intergenic
1041228663 8:55727387-55727409 ACCAGACAGAAGTACAGATAAGG + Intronic
1041444382 8:57934034-57934056 AGGAAACTGAAGCACAGAGAAGG + Intergenic
1042202729 8:66296561-66296583 AGCAAAGAAAATTACAGAGAAGG - Intergenic
1042343730 8:67706294-67706316 ATCAGACAGAAGTTCAGATAAGG - Intronic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1044439480 8:92206947-92206969 ATCAGACAGAAGTGCAGATAAGG + Intergenic
1045446173 8:102266654-102266676 AACAAATTGAAGAACAGAGAGGG - Intronic
1045809932 8:106209579-106209601 ATGAAAGACAAGTACACAGAAGG - Intergenic
1045897399 8:107236088-107236110 AGAAAACTGAAGGACAGAGAAGG - Intergenic
1046545342 8:115642316-115642338 ATCCAACAGAAACACACAGATGG + Intronic
1047398708 8:124527838-124527860 ATCAACCAGGAATAGAGAGATGG + Intronic
1047552570 8:125891668-125891690 ATAAAACAGAAATAGAGAAATGG - Intergenic
1047837789 8:128713187-128713209 ATGAAGCAGAAAAACAGAGAAGG - Intergenic
1047954059 8:129959951-129959973 CACAGACAGAAGTACAGAGCTGG + Intronic
1048086570 8:131187053-131187075 ATCAAACTGAATTACAGTGCTGG - Intergenic
1048140422 8:131788981-131789003 ATGAAAAAGAAGCTCAGAGAAGG + Intergenic
1048716439 8:137276143-137276165 ATAAAACAGAAGTATAGACAAGG + Intergenic
1049500603 8:142961790-142961812 ACCAGGCAGAAGTACAGATAAGG - Intergenic
1049995715 9:1032049-1032071 CTGAGACAGAAGTTCAGAGAAGG - Intergenic
1050657942 9:7849561-7849583 ACCAGGCAGAAGTACAGATAGGG - Intronic
1050786332 9:9407003-9407025 AGAAAACTGAAGTTCAGAGAGGG - Intronic
1052467047 9:28841684-28841706 TTTAAACAGATGAACAGAGAAGG + Intergenic
1055193616 9:73559343-73559365 GTAGAACAGAAGTTCAGAGAGGG + Intergenic
1055591044 9:77814108-77814130 AAGAAACAGAAGGACAGAGGGGG + Intronic
1055823342 9:80294764-80294786 ATCAAACAGCAATGCAGAAAAGG - Intergenic
1055972415 9:81924854-81924876 ATGAAACCGAAGCCCAGAGAGGG - Intergenic
1055974168 9:81939926-81939948 ATGAAACCGAAGCCCAGAGAGGG - Intergenic
1055979147 9:81984511-81984533 ATGAAACCGAAGCCCAGAGAGGG - Intergenic
1056009216 9:82308994-82309016 ATCAAACAGAGGGAGAGAGTGGG - Intergenic
1056677646 9:88688975-88688997 ATCAGACAGAAGTACAGATAAGG - Intergenic
1056795664 9:89657075-89657097 AGAACACAGAAGCACAGAGAAGG + Intergenic
1057001820 9:91516991-91517013 ATCAAAAAGCAGAACAGAAAAGG - Intergenic
1058771596 9:108238993-108239015 ATCAAACATAAGGATAGATATGG - Intergenic
1058793393 9:108473137-108473159 ATCAAACACAAGAAAAGAGAGGG + Intergenic
1059056011 9:110980575-110980597 ATCCCACAGAAGTAGAGAGTAGG + Intronic
1060306679 9:122419950-122419972 ATCAGAGAGAAGTGCAGATAAGG + Intergenic
1060332089 9:122682516-122682538 ACCAAAAATAAGTAAAGAGAAGG + Intergenic
1061830520 9:133290480-133290502 ATCAGACAGAAGTGAAGATAAGG + Intergenic
1062070842 9:134554194-134554216 AGCAAACAGAAAGCCAGAGATGG + Intergenic
1062233404 9:135495958-135495980 AGAAAACTGAAGTTCAGAGAGGG - Intronic
1203472796 Un_GL000220v1:123815-123837 AGCAAAAAGAAGAAAAGAGAAGG - Intergenic
1186077035 X:5891766-5891788 ATGAAATTGCAGTACAGAGATGG - Exonic
1186969522 X:14825390-14825412 CTTAAACAGAAACACAGAGAGGG - Intergenic
1188686903 X:33080604-33080626 ATCAGACAGAAGTGAAGATAAGG + Intronic
1188980929 X:36726461-36726483 ACCAAATTGAAGTAAAGAGAGGG - Intergenic
1189073018 X:37885286-37885308 ACCAGACAGAAGTGCAGATAAGG + Intronic
1189247296 X:39572958-39572980 ACCACACAGAAATATAGAGAGGG + Intergenic
1189650565 X:43184525-43184547 ATGAAACAGAGGCATAGAGAAGG + Intergenic
1189881902 X:45502914-45502936 ATCACAGAGCAGGACAGAGAAGG - Intergenic
1190487435 X:50941878-50941900 ACCAAACATGGGTACAGAGAAGG - Intergenic
1190526166 X:51331871-51331893 ATCAAAGAGAAAGATAGAGAAGG + Intergenic
1191789009 X:64948609-64948631 ATCAGACAGAAGTACAGATAAGG - Intronic
1192730551 X:73798936-73798958 ATCAAGCAGAAGTGCAGATAAGG + Intergenic
1193094172 X:77528283-77528305 ATTTAACGGAAGCACAGAGATGG - Intronic
1193330965 X:80235508-80235530 ACCAGACAGAAGTGCAGATAAGG + Intergenic
1193365320 X:80624569-80624591 ATAAAAGTGAACTACAGAGAAGG - Intergenic
1193705469 X:84815934-84815956 CTCAGACAGAAGTGCAGATAAGG + Intergenic
1194029409 X:88793136-88793158 ATCAACAAGAAGTTCAGAGATGG + Intergenic
1194086051 X:89530392-89530414 ATCAGACAGAAGTGCAGATAAGG + Intergenic
1194252171 X:91589379-91589401 TTCTACCAGAAGTACAAAGAGGG + Intergenic
1194676342 X:96798308-96798330 ACCAATCTGAAGCACAGAGAGGG - Intronic
1194819650 X:98490085-98490107 ATCATCGAGAAGTACAGAGGTGG + Intergenic
1195219815 X:102736007-102736029 ACCAGACAGAAGTGCAGATAAGG + Intronic
1195275518 X:103276695-103276717 TTCAGACTGAAGGACAGAGAAGG - Exonic
1195955533 X:110325809-110325831 AGCAAACAGAAGCAAACAGAAGG - Intronic
1197013757 X:121598937-121598959 ATCAAGCAGAGGAACATAGAAGG - Intergenic
1197307057 X:124855718-124855740 ACCAAACTGAATTATAGAGACGG - Intronic
1197692316 X:129515133-129515155 CAAAAACAAAAGTACAGAGAAGG + Intronic
1197692445 X:129516665-129516687 ATGATACTGAAGCACAGAGAGGG + Intronic
1197863320 X:130993068-130993090 ATCAAACAAAAGAGCACAGATGG - Intergenic
1197896271 X:131318869-131318891 ATCAAACAGAACAGCACAGATGG + Intronic
1197981703 X:132224060-132224082 ATGAAAGAGAAGCTCAGAGAAGG - Intergenic
1198252074 X:134889690-134889712 ATAAAAAAAAAGTACAGAGAAGG + Intronic
1198269264 X:135039169-135039191 CTCAAACAGAACAACAGAGCTGG - Intergenic
1198539660 X:137623820-137623842 ATTACACAGAAATGCAGAGAAGG - Intergenic
1200438707 Y:3186264-3186286 ATCAGACAGAAGTGCAGATAAGG + Intergenic
1201894256 Y:18976855-18976877 AACAAACAAAAGTAAAGAAAAGG + Intergenic
1202104851 Y:21352625-21352647 AGCAAACAGAGAAACAGAGAGGG - Intergenic