ID: 1153696068

View in Genome Browser
Species Human (GRCh38)
Location 18:7643292-7643314
Sequence CTATGTTTCTTAAGGCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153696065_1153696068 -7 Left 1153696065 18:7643276-7643298 CCATTATTGGAAAAACCTATGTT 0: 1
1: 0
2: 1
3: 40
4: 261
Right 1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 159
1153696063_1153696068 5 Left 1153696063 18:7643264-7643286 CCAAAATAAAACCCATTATTGGA 0: 1
1: 0
2: 2
3: 20
4: 275
Right 1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 159
1153696061_1153696068 6 Left 1153696061 18:7643263-7643285 CCCAAAATAAAACCCATTATTGG 0: 1
1: 0
2: 3
3: 19
4: 331
Right 1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 159
1153696064_1153696068 -6 Left 1153696064 18:7643275-7643297 CCCATTATTGGAAAAACCTATGT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153696068 Original CRISPR CTATGTTTCTTAAGGCCAAA AGG Intronic
907035183 1:51210200-51210222 CCAAGTTTGTGAAGGCCAAAAGG + Intergenic
907634882 1:56124411-56124433 CTCTGTTTTTTAAAGCCAGATGG + Intergenic
909180217 1:72414503-72414525 TTTTGTTTTTTAAGGCCAACAGG - Intergenic
910458943 1:87427376-87427398 CTACTTTTCCTAAGTCCAAATGG + Intergenic
912333959 1:108845474-108845496 CTCTGTTCCTTCAGGCCAAAGGG + Intronic
914316225 1:146514278-146514300 CTACTTTTCCTAAGTCCAAATGG + Intergenic
914498130 1:148219083-148219105 CTACTTTTCCTAAGTCCAAATGG - Intergenic
914895430 1:151667436-151667458 CTTTTATTGTTAAGGCCAAAAGG - Intronic
917317678 1:173742818-173742840 TAATGTTTCTTAAGGCCAATGGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922001682 1:221485095-221485117 ATATGTTTCTCAAGAGCAAATGG + Intergenic
923397206 1:233578641-233578663 CATTGTTTCTCAAGCCCAAATGG + Intergenic
1069111669 10:64454821-64454843 CTAAGCTTCTTAAGGGCAAAGGG + Intergenic
1070918228 10:80168455-80168477 TTGTGTTGCTTAAGGCCCAAGGG - Intronic
1071361284 10:84848543-84848565 CTATGGTCCTCAAGGCAAAATGG - Intergenic
1073857493 10:107694358-107694380 CAATGTTGCTGAAAGCCAAAAGG + Intergenic
1074300652 10:112230682-112230704 CCTTGTTTGTTAAGACCAAAAGG + Intergenic
1074443239 10:113497073-113497095 AAAGGTTTCTCAAGGCCAAAGGG + Intergenic
1074739288 10:116469308-116469330 CTATGATACTTACGGGCAAATGG - Exonic
1075612551 10:123865380-123865402 GTAGGTTTCTTAAAACCAAAGGG - Intronic
1076913542 10:133405056-133405078 CTATGTTTCTTGAGGCCGGGTGG + Intronic
1080271524 11:30455590-30455612 CTTTGTTTTTTAATGCCAAAAGG + Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1081153525 11:39661568-39661590 ATATATTTTTTAAGGCCACAAGG - Intergenic
1081388955 11:42506029-42506051 CTATGTTTTATAAGGAGAAAGGG - Intergenic
1081529518 11:43948279-43948301 CTATTTTTCCAGAGGCCAAAGGG - Intergenic
1083038534 11:59664109-59664131 CTTTGTACCTTAGGGCCAAAGGG - Intronic
1085736921 11:79046924-79046946 CTATGTTTCTGAATGCTAGATGG - Intronic
1086417947 11:86607877-86607899 TTCTGTTTCTGAAGGTCAAAAGG - Intronic
1086982646 11:93215727-93215749 CTATGTATCACAAGGGCAAAGGG + Intergenic
1090810051 11:130231012-130231034 CTATCTTTCTTAAGGCCAGGAGG - Exonic
1092560292 12:9605604-9605626 CGATCTTGCTTATGGCCAAATGG - Intronic
1092855146 12:12666148-12666170 CTATGTTTCTGAGGGGAAAAGGG - Intronic
1093483854 12:19631744-19631766 GTAAGTTTCTAAAGGCAAAAAGG + Intronic
1093699546 12:22203483-22203505 GTATGTTTCTCAAGGCCAGAAGG + Intronic
1093966511 12:25332580-25332602 CTATGTTTCTTTATTCCAAAAGG + Intergenic
1094602222 12:31919474-31919496 GTATGTATCTAAAAGCCAAAAGG + Intergenic
1095560751 12:43562392-43562414 ATATTTTCCTGAAGGCCAAAAGG + Intergenic
1096479213 12:51926770-51926792 CTATGATCCTTCAGGCCAAGAGG + Intergenic
1096797439 12:54086551-54086573 CTCAGTTTCTCAAGGCCAGAAGG - Intergenic
1098430045 12:70409042-70409064 CTTTGGATCTAAAGGCCAAAAGG + Intronic
1101502204 12:105314696-105314718 CTGTGTTTCATAAGTCCAAGGGG + Intronic
1101997416 12:109534918-109534940 CTAAATTTCTTGAGGCCACAAGG - Exonic
1105822593 13:24093143-24093165 CTATATTTCATAAGGTTAAAAGG + Intronic
1107147926 13:37079463-37079485 CTTTGATTCTTAAGGCCATATGG + Intergenic
1108466935 13:50726146-50726168 CTAAGTGTCCTAAGGCCACAGGG - Intronic
1108944856 13:56009376-56009398 TTATTTTTCTTATGGACAAAGGG + Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1115848447 14:37565490-37565512 CTATGTTTAAGAAGGCCAATGGG - Intergenic
1116855518 14:49949005-49949027 CCATGTTTCTTAGGGAGAAAAGG + Intergenic
1117471088 14:56045785-56045807 CTATATTTCTTATGGCCTTATGG - Intergenic
1118100646 14:62597641-62597663 CTCTTTTTCTAAATGCCAAAAGG - Intergenic
1119217271 14:72878744-72878766 CTTTATTTCTCAAGACCAAAGGG + Intronic
1121033188 14:90676652-90676674 CCATGTTTTTTCAGGCCAACCGG - Exonic
1124186806 15:27537766-27537788 CTAGTTGTATTAAGGCCAAAAGG + Exonic
1124856862 15:33397688-33397710 CTATGATTCTCACTGCCAAAAGG - Intronic
1125151265 15:36535153-36535175 GTATGCTCCTTAAGGCTAAAAGG - Intergenic
1125276908 15:38003401-38003423 CTATGTTCATCAAGGCCTAAGGG + Intergenic
1126461357 15:48918354-48918376 GTGTGTTTCTCAAGGCCATATGG + Intronic
1127353116 15:58172177-58172199 GTAAGTTTCTTAAGGCTACATGG - Intronic
1129368600 15:75072852-75072874 GAATTTTTCTTAAGGCCATATGG + Intronic
1131690389 15:94820831-94820853 CTCAGTATCTTAAGGCCAATGGG - Intergenic
1137039572 16:35598106-35598128 TTAGCTTTCTTAAGGCCCAAAGG - Intergenic
1138054542 16:53819001-53819023 CAATGTTGCTTAAGGCCAATTGG - Intronic
1138861008 16:60757459-60757481 CTATGTTTTTTAAGGACAAGTGG - Intergenic
1140485996 16:75293794-75293816 CTATGTATCTTAATCACAAATGG - Exonic
1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG + Intronic
1155889185 18:31245181-31245203 CTATGCTTCATCAGGCAAAATGG - Intergenic
1156891973 18:42201029-42201051 TTATGGTTCTTTATGCCAAAAGG + Intergenic
1158804626 18:60955377-60955399 CTTTCCTTTTTAAGGCCAAATGG - Intergenic
1160383187 18:78476214-78476236 CTATGTTTGAGCAGGCCAAAAGG + Intergenic
1163814926 19:19458976-19458998 CCATGTTTCTTAAAGAAAAAAGG - Intronic
1165726443 19:38116202-38116224 TTATGTTTCTTAATGGCACAGGG - Intronic
925207742 2:2021542-2021564 CTAAGTTTCTTAAGATCAGAAGG - Intronic
927839526 2:26430628-26430650 CCAAGTTTCATAAGACCAAATGG - Intronic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
928104910 2:28463520-28463542 CTTTGATTCTTTAGGCCAGAAGG + Intronic
930257150 2:49105471-49105493 CTTTGTTTTTTAAGCACAAAAGG - Intronic
930418113 2:51115703-51115725 TTTTGCCTCTTAAGGCCAAATGG - Intergenic
930646527 2:53914903-53914925 CTATATTGCTAAAGGCCCAAAGG + Intronic
930848321 2:55929759-55929781 CTCTCTTTCTGAATGCCAAACGG + Intergenic
930898788 2:56478725-56478747 TTATGTTTCTTAAGCACACATGG - Intergenic
931755616 2:65371619-65371641 CTATGTTTCTTAAAGTGTAACGG + Intronic
936736535 2:115449685-115449707 ATATGGAGCTTAAGGCCAAATGG - Intronic
937305590 2:120868597-120868619 CTTTGTTTCTGAATGGCAAAGGG - Intronic
939349102 2:141009943-141009965 CTGTGTTTCTTGAGGGCCAATGG + Intronic
940462311 2:153980836-153980858 CTTTGTTTCTTAAAGCCGTAAGG + Intronic
942360198 2:175164630-175164652 TTATGTTTCTCAAGGTTAAAAGG - Intronic
942526031 2:176853873-176853895 CTATTATTCTAAAGGGCAAAAGG + Intergenic
945798973 2:214400960-214400982 CTATGTATATTAATGCTAAAGGG - Intronic
946263238 2:218514634-218514656 CTATATTTCTTAATTACAAAAGG - Intronic
946590248 2:221239000-221239022 GTATGTTTCCTAAGCTCAAAGGG - Intergenic
948410802 2:237759019-237759041 CTATGTTTATTAACATCAAAAGG - Intronic
1175740728 20:61418125-61418147 CTCTGTCTCTTGAGACCAAAGGG - Intronic
1177071052 21:16508710-16508732 ATGTGTTTCTTAAGCTCAAAGGG + Intergenic
1178412887 21:32380218-32380240 CTATGTTTCTTCTGGAGAAAAGG + Intronic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
949745518 3:7287534-7287556 CTATGCTTCTTAAGTACAACAGG - Intronic
951195306 3:19817007-19817029 CTATGTTTATTAAGTCAAGATGG + Intergenic
952832743 3:37578685-37578707 TTATTTTGTTTAAGGCCAAAAGG - Intronic
955866043 3:63385583-63385605 TGATGTTTCTTTAGTCCAAAGGG - Intronic
956004665 3:64765678-64765700 CTGTGTTTCTAAAAGCCATACGG + Intergenic
956173059 3:66448044-66448066 TTCTGTTTATTAAGGACAAATGG + Intronic
958684968 3:97380479-97380501 CTGTGTTCCTGAAGCCCAAAGGG - Intronic
960610210 3:119548727-119548749 CTCTGTTTCTTATAGCAAAAGGG - Intronic
963094990 3:141526660-141526682 CTCTGTTTCTTCAGGCCAACTGG + Intronic
963855848 3:150252508-150252530 CTATTTTTCATTAGGCCAAGAGG + Intergenic
965994271 3:174860482-174860504 CTATGTGTCTTATGGACAAATGG + Intronic
967141186 3:186562031-186562053 CTTTCTTTTTTAAGGCCAAATGG - Intronic
967732549 3:192919090-192919112 CTATGTTTCTCACAGCCAATGGG - Intergenic
970903464 4:21187377-21187399 TAATGTTTATTAAGGGCAAAGGG + Intronic
974957375 4:68658653-68658675 CTAGATTGCTTAAGGCCACAGGG - Intronic
975085576 4:70334542-70334564 CTATGAATCTTAAGGGAAAATGG + Intergenic
975618670 4:76273990-76274012 CTATGTTTTTTATGCGCAAAAGG - Intronic
975861840 4:78685867-78685889 CTATGTTTTTTAGGGACTAAAGG - Intergenic
976315027 4:83650990-83651012 CAATGTTTCTTAAGGGCCAAAGG - Intergenic
978230064 4:106386709-106386731 CTATTTTTCTTACGGCCAATGGG - Intergenic
978287846 4:107099290-107099312 CCATGTTCCCTAAGGCCTAAGGG - Intronic
978938406 4:114407713-114407735 CCATGTTTCTCAATTCCAAATGG + Intergenic
982560481 4:156923346-156923368 CTATTTCTCTTAAGGCTCAAAGG - Intronic
993274354 5:85837465-85837487 CTATGTTTCATAAGGCAACATGG - Intergenic
995334010 5:110977714-110977736 CTATTTTTCTTAAGTCTTAAAGG - Intergenic
1000289711 5:159859110-159859132 GTATGTTTCTTCAGCCCAGACGG - Intergenic
1001320614 5:170677796-170677818 CTTTGTTTCTTTAAGGCAAATGG + Intronic
1003949525 6:11104918-11104940 CTATTTGTGTTATGGCCAAAAGG - Exonic
1008254887 6:49285579-49285601 CTTTCTTTTTTAAGGCTAAATGG + Intergenic
1008491413 6:52090598-52090620 CTTTATTTCTTCAGGCCTAAGGG + Intergenic
1010000218 6:70941186-70941208 CTATGTTTCTAGAGGCCTAGGGG - Intronic
1010229050 6:73519295-73519317 CTAGGTTTCTTTATCCCAAAAGG - Intronic
1010992376 6:82493879-82493901 CTGAGTTTTTTAAGCCCAAAAGG - Intergenic
1011980215 6:93365445-93365467 CTATGTTTCTATAAGGCAAAGGG + Intronic
1013854604 6:114556735-114556757 CTAGGTTTCTTTTGGGCAAATGG + Intergenic
1017199534 6:151737339-151737361 CAATGTTTCTTGAGGACAATTGG - Intronic
1021942652 7:25694438-25694460 TGATGTTTCTAAGGGCCAAATGG + Intergenic
1022182419 7:27934337-27934359 CTCTGATTTTTAAAGCCAAAAGG + Intronic
1023157604 7:37266338-37266360 CTATTTTTCTTATTGCCAGAGGG + Intronic
1024385348 7:48744946-48744968 ATATGTTTTCTAAAGCCAAATGG - Intergenic
1027457127 7:78406445-78406467 CTATGTTTTGTTAGTCCAAAGGG - Intronic
1028185846 7:87784843-87784865 CTATGTTTCCTTAGCCCTAAGGG + Intronic
1029293972 7:99524755-99524777 CTAGGTTTCTCAATGCCCAAAGG - Intronic
1031342091 7:120615361-120615383 CTCAGTTTCTGAAGGCCAAATGG + Intronic
1031528958 7:122853456-122853478 CTTTGTTGCTTTAGCCCAAAGGG + Intronic
1033523001 7:142181586-142181608 CTATGTTTCCTTAGCCCCAAGGG + Intronic
1033631014 7:143158071-143158093 TTATGATTCAAAAGGCCAAATGG - Intergenic
1036068213 8:5408910-5408932 CAATGGTGCATAAGGCCAAAGGG + Intergenic
1037757172 8:21718613-21718635 CTATGTCCCTTCAAGCCAAAGGG + Intronic
1039370950 8:36983289-36983311 CTATGGTTCTTAATGCCCTAAGG + Intergenic
1042413763 8:68495359-68495381 CTATGTTTATTAAGATAAAATGG - Intronic
1044395184 8:91702925-91702947 CAATGTTCCTTAAGCCCCAAGGG + Intergenic
1044489981 8:92801946-92801968 CTATATTTTCTAAGGCAAAAGGG - Intergenic
1044861293 8:96526181-96526203 CTATGTTTGTTATGGGCATAAGG + Intronic
1045511300 8:102814080-102814102 CAATGTTTCTCAAAGCCACAGGG + Intergenic
1047197128 8:122731991-122732013 GTTTGTTTCTTAAGACCAACAGG + Intergenic
1047404032 8:124569991-124570013 CTTTCTTTCTTCAGACCAAATGG - Intronic
1047766433 8:127993737-127993759 CTTTGTTTCTTAAGGCAGACTGG - Intergenic
1048019776 8:130527702-130527724 CTATCTTTCTTAAATCAAAAAGG + Intergenic
1048628031 8:136208135-136208157 CTGTTTTTCTCAAGCCCAAAAGG + Intergenic
1049473369 8:142786028-142786050 CTATGTTTCTGAGGGCCTGACGG + Intronic
1050120226 9:2300189-2300211 CAATGTTTCTGGAGGCCTAAAGG - Intergenic
1051022086 9:12556722-12556744 CTAAGTTCCTTGCGGCCAAAGGG - Intergenic
1051465095 9:17368172-17368194 CAATGTTCCTTAAAGCCCAAGGG - Intronic
1052569892 9:30206771-30206793 ATTTGTTTCTTAAGCCAAAAGGG + Intergenic
1052968739 9:34363400-34363422 CATTGTTTTTTAAGGTCAAAAGG - Intergenic
1053569193 9:39286543-39286565 ATATGTTTGTTTAAGCCAAACGG + Intronic
1054090822 9:60845524-60845546 ATATGTTTATTTAAGCCAAACGG + Intergenic
1054112233 9:61121081-61121103 ATATGTTTATTTAAGCCAAACGG + Intergenic
1054127950 9:61332464-61332486 ATATGTTTATTTAAGCCAAACGG - Intergenic
1058212599 9:102188879-102188901 CTATATTACTAAAGGCAAAAGGG - Intergenic
1060911312 9:127353353-127353375 ATATTTATCTTAAGTCCAAAAGG + Intronic
1188114992 X:26231955-26231977 CTATGTGCCTGCAGGCCAAAGGG + Intergenic
1188688251 X:33096813-33096835 CAATATTTCTTTAGGTCAAAGGG + Intronic
1191997022 X:67106423-67106445 CTATATTTCTTGAGGGCAAGGGG + Intergenic
1193673588 X:84419361-84419383 TAATGTTCCTTAAGGCCCAAGGG - Intronic
1195485640 X:105402583-105402605 CTTTGTTCCTGAAGGACAAACGG + Intronic
1197141152 X:123118590-123118612 CTAGGTTTTGCAAGGCCAAATGG + Intergenic
1197998762 X:132409858-132409880 ACATGTTTTTTAAGTCCAAAAGG - Intronic
1198064189 X:133079963-133079985 ACATGTTTCCTAAGGCCACATGG + Intronic
1199637967 X:149831559-149831581 TTAGCTTTCTTAAGGCCCAAAGG + Intergenic