ID: 1153707104

View in Genome Browser
Species Human (GRCh38)
Location 18:7757171-7757193
Sequence TAAAAGGCCTACTTCAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153707104_1153707106 6 Left 1153707104 18:7757171-7757193 CCTAATCTGAAGTAGGCCTTTTA 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1153707106 18:7757200-7757222 TCTGATACCATGTCATCTTCTGG 0: 1
1: 0
2: 2
3: 8
4: 136
1153707104_1153707108 29 Left 1153707104 18:7757171-7757193 CCTAATCTGAAGTAGGCCTTTTA 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1153707108 18:7757223-7757245 TCACAATGTTGAATTATAGTAGG 0: 1
1: 0
2: 0
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153707104 Original CRISPR TAAAAGGCCTACTTCAGATT AGG (reversed) Intronic
904939471 1:34155387-34155409 TTAAAGGCCTCATTCAGATCTGG + Intronic
908803929 1:67910047-67910069 TAAAAGTCCTACTGCAGCTATGG - Intergenic
909279051 1:73725575-73725597 GAAATGGCTGACTTCAGATTTGG - Intergenic
909947345 1:81678327-81678349 TAAAAGGCCACTTTCAAATTTGG - Intronic
910545388 1:88410089-88410111 AAAAAGGCCTCCTACATATTGGG - Intergenic
911380810 1:97111592-97111614 TGAAAGGCCTACTCTAGATTGGG - Intronic
911484086 1:98483704-98483726 TGAAAAGTCTACCTCAGATTTGG + Intergenic
913422198 1:118682599-118682621 TAGAAGTCCTACTTAAGACTGGG + Intergenic
915236317 1:154485657-154485679 GAGAGGGCCTACTCCAGATTAGG + Intronic
915910726 1:159913661-159913683 TCAAAGGCCTCCTTCAGCTGTGG + Intergenic
916585060 1:166143226-166143248 GAAGAGGCCTAATTCAGACTGGG + Intronic
918904431 1:190474957-190474979 TAAAAGGCCAACTTTAAAGTGGG + Intronic
921845486 1:219875296-219875318 TGAAAAGCCTACTTTAGATGAGG + Intronic
923954684 1:239002663-239002685 TAAAATGCCTGCTTTGGATTTGG + Intergenic
1063905160 10:10774067-10774089 TAAATGGCCTGATTCAGATTTGG - Intergenic
1064927101 10:20581511-20581533 TAAAAGAGCTACTTGAGACTAGG - Intergenic
1065370919 10:24985339-24985361 TAAAAGACCTAATTCTGATGTGG + Intronic
1066262875 10:33746044-33746066 TAAAAGGCCAAGATCAGAATAGG - Intergenic
1068882281 10:62063021-62063043 TAAAATGCCTCCTACATATTTGG + Intronic
1070232948 10:74590552-74590574 TAAAAGAACTACTCCAGAGTAGG + Intronic
1072292303 10:93975308-93975330 TAAAAGTCCTAGTTCAGGTCAGG - Intergenic
1073515779 10:104074447-104074469 TCAAGGACCTACTTCAGATGAGG + Intronic
1077466523 11:2736190-2736212 GGAAAGGCTTCCTTCAGATTTGG - Intronic
1078988330 11:16616126-16616148 TGAATGGCCAACCTCAGATTTGG - Intronic
1085144850 11:74185291-74185313 TAAAAGACATACTTCAGACCAGG - Intronic
1086201900 11:84213349-84213371 TAAAAGGCCTAGTTCACACTGGG + Intronic
1087360972 11:97158756-97158778 GAAAAGCCCTGCTTCAGAGTTGG - Intergenic
1088362402 11:109004704-109004726 TATAAAGCCTTCTTCTGATTGGG + Intergenic
1088756646 11:112890521-112890543 AAAAGGGCCGACTTCAGAGTTGG + Intergenic
1092986790 12:13853579-13853601 CAAAAGGCCTGCTTCAGGTTAGG - Intronic
1094290942 12:28849449-28849471 TAAAAGGCTTCCTTCATCTTGGG + Intergenic
1100039077 12:90290596-90290618 TAAAAGGAATACCTGAGATTGGG + Intergenic
1107870235 13:44739554-44739576 TAAAAGGAATACTTGAGACTGGG + Intergenic
1109622048 13:64923790-64923812 TAAAAGGCAAACTACAGAATAGG + Intergenic
1110868392 13:80422790-80422812 AAAAAGAACTACTTGAGATTGGG + Intergenic
1112248946 13:97760796-97760818 TAAAAGGCATCCTACAGAATGGG - Intergenic
1112953868 13:105035516-105035538 AAAAAGGACTATTCCAGATTAGG + Intergenic
1114845692 14:26318632-26318654 TTAAAGTCTTACTGCAGATTTGG + Intergenic
1118156062 14:63243158-63243180 TAAAAGAGCTTGTTCAGATTGGG - Intronic
1123712411 15:22998361-22998383 TAAAAGGCCAACTTCACTTAGGG - Intronic
1129544847 15:76384906-76384928 TAAAAGGCCTTATTCATATCAGG + Intronic
1133402008 16:5495028-5495050 TAAAAGACATACCTCAGACTGGG + Intergenic
1133844728 16:9443356-9443378 TAAAATGCCTTCTTCATTTTGGG + Intergenic
1134385140 16:13764606-13764628 AAAAAGAACTACTTGAGATTGGG + Intergenic
1134605004 16:15563534-15563556 TAAACAGGCTACCTCAGATTGGG + Intronic
1136749553 16:32621628-32621650 AATAATGCCTAATTCAGATTAGG + Intergenic
1139659207 16:68409473-68409495 TAAAATGCCCACTTCAGAGATGG - Intronic
1141555171 16:84832423-84832445 TATAAGGACTACGTCTGATTTGG - Intronic
1203051688 16_KI270728v1_random:880838-880860 AATAATGCCTAATTCAGATTAGG + Intergenic
1144283957 17:13754538-13754560 TAAAAGGGCAAATTCAGACTAGG - Intergenic
1146529250 17:33594196-33594218 TAGATGGCCTACGTCAGAATAGG - Intronic
1149694474 17:58605786-58605808 AAACAGGACTACTTTAGATTAGG - Intronic
1149797103 17:59530675-59530697 TGAAAGCCCTACTTCAGCTTTGG - Intergenic
1153707104 18:7757171-7757193 TAAAAGGCCTACTTCAGATTAGG - Intronic
1158115302 18:53988962-53988984 TATATACCCTACTTCAGATTTGG - Intergenic
1159502153 18:69287331-69287353 TAAAATGCTTAATTCAGATAGGG + Intergenic
1159671824 18:71229748-71229770 TAAATCTCCTCCTTCAGATTAGG + Intergenic
1164863495 19:31582524-31582546 TAGGAGACCTACTGCAGATTAGG - Intergenic
1164906114 19:31969546-31969568 TCAAATGCTTAGTTCAGATTTGG - Intergenic
925526865 2:4813044-4813066 ATAAAGGCCTACTCCAGACTGGG + Intergenic
926966529 2:18420306-18420328 TGAAAGGCGTACTTCAGACTTGG - Intergenic
927222427 2:20725768-20725790 CAAAAGGCCTACTCCTGATTAGG - Intronic
927288489 2:21381145-21381167 GAAAAGGCAAACTACAGATTGGG + Intergenic
928907025 2:36379345-36379367 TAAATGGACCACTTCAGTTTGGG - Intronic
930616261 2:53597862-53597884 TAAAAAGCATACTTCAGATGAGG - Intronic
940777168 2:157897164-157897186 AATAAGGCTTACTTCAGTTTTGG + Intronic
943283578 2:185968074-185968096 TAAAAGACAAACTACAGATTTGG + Intergenic
947253583 2:228136355-228136377 TAAAATCACTACTTCAAATTTGG - Intronic
948077385 2:235175380-235175402 TAGAAGGAATACTTCAGCTTAGG + Intergenic
1174724800 20:52850470-52850492 TTAAAGGCCTACATGAGATGGGG + Intergenic
950019167 3:9774512-9774534 TGAAAGGCAAACTTCAGACTGGG + Intronic
952522620 3:34176710-34176732 TAAAAGGGCTCCTTCAGGTCAGG - Intergenic
955090824 3:55749082-55749104 CAAAAGGCCTTCTGCAGACTGGG - Intronic
956480992 3:69673967-69673989 CAAAAGGTCCACTTCAGCTTCGG + Intergenic
958113647 3:89184975-89184997 TAAAAAGCCAACTTCTTATTGGG + Intronic
960374170 3:116878167-116878189 GAAAGTGCCTTCTTCAGATTAGG + Intronic
961058611 3:123809942-123809964 TAAAAGGCCTACTCCACAGCTGG + Intronic
961992293 3:131205022-131205044 TAAAAGGCCCAGTCCAGATCAGG + Intronic
966382033 3:179354105-179354127 AAAAGATCCTACTTCAGATTAGG + Intronic
966438224 3:179913456-179913478 AAAAAGCCCTACAACAGATTAGG - Intronic
967678292 3:192327485-192327507 TAAACTACCTAATTCAGATTTGG + Intronic
971093937 4:23376474-23376496 TAGAAGCCCCACTTCACATTTGG - Intergenic
971140820 4:23922939-23922961 TAAAATGTCTGCTTCAGTTTCGG - Intergenic
974475710 4:62376976-62376998 TAATTGGCCTACTTCAATTTGGG - Intergenic
975094275 4:70439117-70439139 TAAAAAGGCTAGTTTAGATTGGG + Intronic
975632632 4:76418222-76418244 TGACTGGCCTACTTCAGAGTTGG - Intronic
975906127 4:79214501-79214523 TAAAAGGCCAAGTTCAGGATCGG + Intergenic
976312810 4:83629132-83629154 CAAAAGTCCTACTTAAGACTTGG - Intergenic
978863461 4:113479374-113479396 TAAAAGGACTACTTCAAATGAGG + Intronic
979466938 4:121050742-121050764 TCAAAGGCCTTCTTCACATTTGG + Intronic
981163634 4:141530433-141530455 TAAAAGGCAACCTACAGATTGGG + Intergenic
983382296 4:167011846-167011868 TAAAAAGCATACCTCACATTTGG - Intronic
983563963 4:169130324-169130346 TAAAATGCCTGGTTCAAATTAGG - Intronic
983817520 4:172150466-172150488 TGAAGGGGCTACTTTAGATTTGG + Intronic
985340200 4:188943017-188943039 TAAAAGAACTACATAAGATTGGG - Intergenic
985898696 5:2767733-2767755 AAAAAGGCAAACTGCAGATTGGG - Intergenic
986941609 5:12957483-12957505 TTAAAGGCTCACTCCAGATTAGG - Intergenic
987913333 5:24179313-24179335 GAAAAGGCAAACTACAGATTGGG - Intergenic
991978477 5:72206850-72206872 TAAAAGTGCTACTTGAGAGTGGG + Exonic
992129595 5:73678491-73678513 TCAAAGGCCTCCCTCAAATTTGG - Intronic
992548315 5:77837134-77837156 GAAATGGGCTACATCAGATTGGG - Intronic
995295903 5:110521400-110521422 TAAAAGTCATCCTACAGATTAGG - Intronic
998074166 5:139222749-139222771 TGAAAGGGCTACTTCATGTTTGG + Intronic
1000601161 5:163276482-163276504 TCAAAGGCTCACTTCAGAATCGG + Intergenic
1001277620 5:170362010-170362032 TCAAAGGCCTCTTTCAGCTTTGG + Intronic
1001991551 5:176120420-176120442 AATAATGCCTAATTCAGATTAGG + Intronic
1002225325 5:177717702-177717724 AATAATGCCTAATTCAGATTAGG - Intronic
1002268519 5:178053412-178053434 AATAATGCCTAATTCAGATTAGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1006217223 6:32454604-32454626 ATAAAGGCATACTTGAGATTGGG - Intergenic
1009812455 6:68686054-68686076 TTAAAGGCTTTCTTAAGATTAGG + Intronic
1010316318 6:74454837-74454859 TAAAAGGGCTACTTCAACCTTGG + Intergenic
1016263067 6:142197254-142197276 TAAAATGCTTATCTCAGATTAGG + Intronic
1016421277 6:143885786-143885808 TAAAAGACTTACTTCAAATTTGG - Intronic
1016747290 6:147594192-147594214 CAAATGGTCTACTTCAGACTAGG - Intronic
1020908056 7:14090571-14090593 TAAAAAGCCTATTTCAGAAAAGG + Intergenic
1021808257 7:24377984-24378006 TAAAACACCTAGCTCAGATTGGG - Intergenic
1022785016 7:33629936-33629958 TAAAAGGCTAATTTCAGATTTGG + Intergenic
1028290629 7:89060254-89060276 GAAGAGCCCTAATTCAGATTTGG + Intronic
1028433680 7:90777375-90777397 TAAAAAGGCGACTTCAGTTTTGG + Intronic
1029208981 7:98889638-98889660 TAAAAGGATCACTTCAGACTGGG - Intronic
1030247558 7:107400849-107400871 TAAAAGTCATACTTTACATTTGG + Intronic
1032347638 7:131131767-131131789 TAAAAGGCATACTTCTGCTAAGG + Intronic
1035969575 8:4232675-4232697 TAAAATGTCTCCTTCAGTTTAGG - Intronic
1036953725 8:13165318-13165340 TAAGTGGCCTACTTCAGAAAGGG + Intronic
1037294240 8:17383853-17383875 TCAAAGGCCTCCTGCAGCTTTGG + Intronic
1038015079 8:23508039-23508061 TAAAAGGCCTAATCCTGAATGGG + Intergenic
1040876373 8:52156546-52156568 GAAAAGGCCTACATCAGACATGG + Intronic
1042318504 8:67450265-67450287 TAATATGCTTACTTCATATTTGG + Intronic
1042756599 8:72220877-72220899 TTCAAAGCCTACTTTAGATTGGG + Intergenic
1042892285 8:73625986-73626008 TTAAAGGCCTACTTCATGCTGGG + Intronic
1044141802 8:88664490-88664512 TAAAAGGCAACCTACAGATTGGG + Intergenic
1044170267 8:89042878-89042900 CAAAAGTCTTACTTCAGATGTGG + Intergenic
1048315679 8:133360113-133360135 TAAAAACCCTAGCTCAGATTGGG + Intergenic
1050948442 9:11557327-11557349 TAAATGTCCTTCCTCAGATTTGG + Intergenic
1051166423 9:14266831-14266853 TAAAAATCATTCTTCAGATTTGG - Intronic
1052587389 9:30446979-30447001 TAAATGGCCTAATTAAGGTTAGG - Intergenic
1053459236 9:38255778-38255800 AAAAAGGCCTTCTCCAGATGTGG - Intergenic
1055639662 9:78309683-78309705 TAAAAGGACCCCTTCAGATTAGG - Intronic
1056706968 9:88959588-88959610 TAAAAAGTCAACTTCAGACTGGG - Intergenic
1057348553 9:94274935-94274957 TCAAAACCCTACTTCAGATTTGG - Intronic
1058589898 9:106553571-106553593 TAAAAGACATACTACAGAATTGG + Intergenic
1059073978 9:111169867-111169889 TAAAAGTCCAACTTCAAAGTAGG - Intergenic
1059508103 9:114818388-114818410 GAAAAGGCATAATTCAGAGTTGG + Intergenic
1060871365 9:127043661-127043683 TAAAAGACTTACCACAGATTGGG + Intronic
1061688393 9:132303569-132303591 TAAAAGGCATTCCACAGATTAGG + Intronic
1062611132 9:137373985-137374007 TAAAAGGCATTTTTCAGTTTGGG - Intronic
1186193795 X:7092012-7092034 TTAAATGCCTTCTTCAGATTGGG - Intronic
1189839897 X:45064139-45064161 TAAACTGCCTACTTAAGATCAGG + Intronic
1192037402 X:67579437-67579459 TAAAAGCACTACTTCAGAAAAGG + Intronic
1192230913 X:69264411-69264433 TAAAAGGCCTTCTTCATTGTGGG + Intergenic
1192305764 X:69957878-69957900 TAGAAGGTCTAGTTCAGATTTGG - Intronic
1193492641 X:82168100-82168122 CAAGAGGCCTATTTCACATTTGG + Intergenic
1193498292 X:82239996-82240018 TAAAAGGCATACTCGAAATTAGG - Intergenic
1194134812 X:90128361-90128383 TAAAATGATGACTTCAGATTAGG - Intergenic
1195411879 X:104576518-104576540 TAAAAAGCCTACTTAATATTTGG + Intronic
1195499783 X:105582351-105582373 TAAAAAACCTACTTGAAATTTGG + Intronic
1196018238 X:110962230-110962252 TAAAAGGCCAAGTTAAGTTTGGG - Intronic
1197812100 X:130454035-130454057 TAAAACACCTCCTTCAGATGAGG - Intergenic
1199017824 X:142839809-142839831 TTATAGGACTATTTCAGATTAGG - Intergenic