ID: 1153712494

View in Genome Browser
Species Human (GRCh38)
Location 18:7814158-7814180
Sequence CTATAGGGATTGTGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153712494 Original CRISPR CTATAGGGATTGTGGGAGAT GGG Intronic
900411821 1:2516023-2516045 CTATAGGGATGGTGGAGGAGGGG - Intronic
900574244 1:3375147-3375169 CGATGAGGATGGTGGGAGATCGG + Intronic
901899043 1:12342275-12342297 CTTTAGGGATAGAGGGAGAATGG - Intronic
903374662 1:22858385-22858407 CTCCAGGGACTGTGGAAGATTGG + Intronic
905911149 1:41655700-41655722 CAATAGGGAATGTGTCAGATGGG - Intronic
906700507 1:47854031-47854053 TCATATGAATTGTGGGAGATAGG - Intronic
908557230 1:65267822-65267844 CTTTAGGGCTGCTGGGAGATGGG + Intronic
910491444 1:87776941-87776963 CTACAGGGATTCTGTGAAATTGG + Intergenic
914447056 1:147759006-147759028 CAGTAGCGAATGTGGGAGATGGG + Exonic
914450266 1:147785444-147785466 CTATCTGGATTGAGGGAGCTAGG + Intergenic
914928766 1:151910817-151910839 ATAAAGGGAATGTGGGAGGTTGG - Intergenic
916125114 1:161562973-161562995 CTAGAGGGATTCTGGGACACAGG + Intergenic
916939454 1:169664077-169664099 CTATAGGGAGGCTGGGATATGGG - Intronic
917281079 1:173378762-173378784 CTATAGGGAGGCTGGGATATGGG - Intergenic
919763638 1:201113083-201113105 CTGTAGGGATGGGAGGAGATGGG - Intergenic
923768933 1:236920398-236920420 CTCTAGGGATCGTGGCTGATAGG - Intergenic
924874435 1:248085754-248085776 CAATGGGGGTTGTGGGAGAGGGG + Intronic
1063592754 10:7408977-7408999 CTCTAGGGAAGGTGGGGGATGGG - Intronic
1064626540 10:17267057-17267079 CAAAAAGGATAGTGGGAGATAGG - Intergenic
1067345924 10:45439281-45439303 CTATAAGTATTGTGGAAGGTGGG - Intronic
1067837798 10:49652333-49652355 CAATAGGGCTTGGGTGAGATGGG - Intronic
1068658109 10:59594946-59594968 TTAAAGGTATTATGGGAGATAGG + Intergenic
1069142930 10:64850795-64850817 CAAGAGGGATTGTGGGCTATAGG - Intergenic
1069321177 10:67173411-67173433 CTATGGGGAGTGTTGGAGCTGGG - Intronic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1071377355 10:85022211-85022233 CTCTATGGATTGAGGGAGCTGGG + Intergenic
1078666358 11:13328938-13328960 CTGTAGGGATTGAAGGAGATTGG + Intronic
1079136189 11:17777112-17777134 CTTTAGTGATTGTGAGAGCTGGG + Intronic
1082765759 11:57166238-57166260 CTATAGGGACTGGGAGAGGTTGG - Intergenic
1084210940 11:67622087-67622109 CTATAGGGAGGCTGGGATATGGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092198119 12:6562375-6562397 CTATAGGAGTTGTGGGGTATGGG - Intronic
1092913291 12:13167104-13167126 TTATTGGGACTGTGGGAGGTGGG + Intergenic
1093149368 12:15603269-15603291 CCTTAGAGACTGTGGGAGATTGG - Intergenic
1093720426 12:22436578-22436600 CTGTAGGGATCATGGCAGATGGG + Intronic
1095689008 12:45066945-45066967 CAATATGGATTCTAGGAGATAGG - Intergenic
1097712093 12:62928205-62928227 CTATATGGTATATGGGAGATGGG + Intronic
1100050826 12:90446321-90446343 CTATAGGGATGCTAGGATATGGG + Intergenic
1100701404 12:97152352-97152374 TTAAAGGGATTTTGGGATATGGG + Intergenic
1102720291 12:115010128-115010150 CTAAAGGGAGTGGGGGACATGGG + Intergenic
1104229303 12:126868701-126868723 CTATAGGGTTTTTGCGATATAGG + Intergenic
1106754129 13:32804766-32804788 CTAGATGGATGGAGGGAGATGGG - Intergenic
1106956685 13:34945962-34945984 CTAGGTGGATTGTGGGAGTTTGG + Intronic
1108177987 13:47813542-47813564 TTATAGGGATTAAAGGAGATAGG - Intergenic
1113108482 13:106796985-106797007 CTAATGGTATTGTGAGAGATTGG - Intergenic
1117111130 14:52456039-52456061 CGAAAGGGATTGTGGGAGGGTGG - Intronic
1121654493 14:95585341-95585363 ACATAGGAATTCTGGGAGATAGG + Intergenic
1122842034 14:104470678-104470700 CTTCAGGGATTGTGCGAGACGGG + Intergenic
1123634968 15:22295967-22295989 TAAAAGGGATTGGGGGAGATGGG - Intergenic
1125667286 15:41441269-41441291 CTATAAGAATAGTGGGAGAGAGG - Intronic
1127797758 15:62453189-62453211 CTAGAAAGATTTTGGGAGATGGG + Intronic
1137640089 16:50021499-50021521 ATAGAGGGATTGGGGGACATAGG - Intergenic
1139308654 16:66009545-66009567 ATGTTGGGATTGTGGGAGTTTGG + Intergenic
1140730289 16:77850172-77850194 GTACAGGCATTGTAGGAGATGGG + Intronic
1140743851 16:77964132-77964154 CAATAGGGATTCAGGGAGAGGGG - Intronic
1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG + Exonic
1146695954 17:34909320-34909342 GTATATGGATTGGGGGAGAAGGG + Intergenic
1151232900 17:72697507-72697529 TGATGGAGATTGTGGGAGATTGG - Intronic
1153712494 18:7814158-7814180 CTATAGGGATTGTGGGAGATGGG + Intronic
1155293935 18:24368590-24368612 CTAAAGGGATAGAGGGAGACAGG + Intronic
1156584938 18:38421550-38421572 CTAAAGGGATTGGGGAAGATGGG - Intergenic
1164713611 19:30376227-30376249 GTATAGGGATTGGGGGAGAGGGG - Intronic
1166442485 19:42826920-42826942 CTACAGGGACTGTGGGGGTTAGG + Intronic
1166450045 19:42890950-42890972 CTATAGTGACTGTGGGGGTTAGG + Intronic
1166461932 19:42995237-42995259 CTACAGGGACTGTGGGGGTTAGG + Intronic
1167018433 19:46856934-46856956 CTAAAGGGACTGTGGGAGCTTGG + Intergenic
1167639552 19:50673218-50673240 CTTCAGGGAGTGTGGGAGACTGG - Intronic
1168272796 19:55259002-55259024 CTAGGGGGATTGTGGGATAGTGG - Intergenic
925534134 2:4898714-4898736 CTTTAGGTATTTTGGGAGAATGG - Intergenic
926479318 2:13370263-13370285 TAAAAGGGATTGGGGGAGATGGG - Intergenic
928241761 2:29592626-29592648 CTATAGGGATATTAGGAGAAGGG - Intronic
928336556 2:30403463-30403485 CTCTAGGGATAGAGAGAGATGGG - Intergenic
929473795 2:42224205-42224227 CTATAGGGATTGGGAGAAACAGG - Intronic
931997700 2:67854914-67854936 GTAGAGGGATTGTGGTAAATTGG - Intergenic
932725300 2:74174617-74174639 CTTTATGGATGGTGTGAGATAGG - Intronic
937825923 2:126368495-126368517 CTCTAGTGACTGTGGGTGATTGG + Intergenic
937826116 2:126370102-126370124 CTCTAGTGACTGTGGGTGATTGG + Intergenic
941086082 2:161119998-161120020 CTAAAGGGAATCTGGGAGCTGGG + Intergenic
941594250 2:167456053-167456075 CTGTAGGGAATGTGTGAGACTGG + Intergenic
942432437 2:175926903-175926925 ATATATGGATTGTGAGAGACAGG + Exonic
944261823 2:197686202-197686224 CTTTAGGGACTGTGGGGGAAAGG - Intergenic
948017491 2:234702173-234702195 ACATGGGGATTGTGGGAGCTAGG - Intergenic
1172491669 20:35343946-35343968 CTATTTGGATTGTTGTAGATAGG - Intronic
1180058627 21:45373673-45373695 CCATGGGGAATGTGGTAGATGGG + Intergenic
1183409613 22:37647204-37647226 CTACAGGGAGAGTGGGAGAGCGG + Intronic
952633273 3:35495753-35495775 CTATAGGGATTGCCTGTGATGGG + Intergenic
962419422 3:135215100-135215122 GGATAGGGATTCTGAGAGATGGG - Intronic
963554831 3:146773651-146773673 CTATAAGGATTGTGGGGGTGGGG - Intergenic
964177171 3:153838034-153838056 CTATAGGGAGTGAGGCAGAGTGG - Intergenic
966226044 3:177599181-177599203 CTATGGCTATTGTGGGAAATAGG + Intergenic
969946267 4:10786515-10786537 CTAGAGGAATTATGGTAGATGGG + Intergenic
972722328 4:41712720-41712742 CTATAGATATTCTGGGAGAAAGG - Intergenic
972855779 4:43105159-43105181 GTATATGGATTTTGGGAGGTTGG - Intergenic
976357492 4:84136232-84136254 CAATAGGGATTCTGGGAAAGGGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977520959 4:98082881-98082903 CTATTTGGATTGTGGTAGAAGGG - Intronic
980707278 4:136515769-136515791 GTAGAGGAATTGTTGGAGATAGG + Intergenic
980984219 4:139679993-139680015 CTCTAGGGATAGAGGGAGAGGGG - Intronic
981887095 4:149689394-149689416 CTATGGGGCCTGTGGGGGATGGG + Intergenic
983835005 4:172375116-172375138 CTATAGGGATGCTAGGATATGGG + Intronic
986906587 5:12501782-12501804 CTATAGGCTTTGTGAGAGAGAGG + Intergenic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
992049282 5:72928368-72928390 CTATAGGGATGCTAGGATATGGG - Intergenic
994092154 5:95818973-95818995 CTATAGGAGCTGAGGGAGATGGG - Intronic
994400992 5:99278418-99278440 GTATAGGGAATGTGGGAGATAGG - Intergenic
998566782 5:143223002-143223024 CTTTAGAGATGGTGAGAGATTGG - Exonic
999218355 5:149954723-149954745 CTCTAGGGATTGGGTGAGAGGGG + Intergenic
999271800 5:150301060-150301082 CTTCAGGGTCTGTGGGAGATAGG - Intronic
1007425563 6:41743925-41743947 CTATAGTGGTTTTGGGAGACAGG - Intronic
1007821939 6:44566841-44566863 GCATAGGGACTGTGGGACATAGG + Intergenic
1008722754 6:54376950-54376972 CCTTAGGGAATGTGGTAGATGGG + Intronic
1009698218 6:67138308-67138330 CTAAAGTGTTTGTGGGAGTTTGG - Intergenic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1014970264 6:127806066-127806088 CTATAGAGATTATAGGAAATTGG + Intronic
1015355777 6:132275560-132275582 CCAAAGGGATTGTGGGTGAGGGG - Intergenic
1016002914 6:139060631-139060653 CTATAAGTATTGTGGGAACTAGG - Intergenic
1020023972 7:4885497-4885519 ATGTGGGGACTGTGGGAGATGGG - Intergenic
1023849197 7:44140826-44140848 CTCTAGGGAAGGTGGGAGGTGGG + Intronic
1025248843 7:57338158-57338180 CTATAGGGGTGGCGGGAGAAGGG + Intergenic
1026382442 7:69813100-69813122 CTAAGGGGATAGTAGGAGATGGG - Intronic
1026389503 7:69886129-69886151 TTATAGGTATTGAGGTAGATTGG + Intronic
1027671870 7:81110675-81110697 CTATAGCAATTGTGTGTGATAGG + Intergenic
1028481702 7:91313593-91313615 ATATGGGGACTGTGGGAAATGGG - Intergenic
1029310614 7:99660078-99660100 CAATGGGGATTGTTGGAGAGTGG - Intronic
1029622964 7:101701480-101701502 CTACAGCCATTGTGGGAGAGGGG + Intergenic
1031748966 7:125545669-125545691 CTATAGGGGTTGGGGGACAAAGG - Intergenic
1032971534 7:137169529-137169551 ATACAGGGATTGTGAGAGAGAGG + Intergenic
1033385319 7:140868572-140868594 ATATAAGGATTGGGGGAGAATGG + Intronic
1037598603 8:20374698-20374720 CAAAGGGGATTGTGGGAGCTGGG - Intergenic
1037669484 8:21001928-21001950 CGAAAGGCATTGTGGGAGATGGG - Intergenic
1044322197 8:90815289-90815311 CTGGAGGGATTGAGGGAGAGTGG - Intronic
1045858449 8:106790617-106790639 CTATAGGGATGCTAGGATATGGG - Intergenic
1046614104 8:116457069-116457091 AGATAGAGTTTGTGGGAGATAGG - Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1050107296 9:2178797-2178819 CTATAGGTAATGTGGAAGCTAGG + Intronic
1050633404 9:7583954-7583976 GAAGAGGGATTGTTGGAGATGGG + Intergenic
1053130651 9:35613299-35613321 CTTTAGGGAGTGGAGGAGATGGG - Intronic
1056088399 9:83179607-83179629 CTATAGGCACTGTGGTCGATAGG - Intergenic
1056984504 9:91349799-91349821 CTACATGGATTATGTGAGATTGG - Intronic
1057711893 9:97453088-97453110 CTATATGGACAGTGGGGGATGGG + Intronic
1061963713 9:134001418-134001440 CCATAGGGGTTCTGGGAGAGCGG + Intergenic
1185963990 X:4578669-4578691 CTACAGGAATTGGGGGAGGTGGG + Intergenic
1188583546 X:31745052-31745074 CTAATGGGATTCTGAGAGATGGG + Intronic
1190026096 X:46924399-46924421 ATATTGGGATTGTGGGACAGTGG + Intronic
1193526171 X:82592123-82592145 TTTTAGGGATTGTGGGCCATGGG + Intergenic
1195582210 X:106518131-106518153 CTATAGGGGATGTGGGGGATAGG - Intergenic
1199581905 X:149368858-149368880 TTATTGGGATTGTGGGGGAAGGG - Intergenic
1200539708 Y:4443301-4443323 CTATATGCAGTGTGGGAGAAAGG + Intergenic