ID: 1153714526

View in Genome Browser
Species Human (GRCh38)
Location 18:7833436-7833458
Sequence ATGCATATTGATTTTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153714526 Original CRISPR ATGCATATTGATTTTTGGCC AGG Intronic
900710474 1:4110037-4110059 ATGCATTTTTTTTTTTGTCCTGG + Intergenic
900757703 1:4448436-4448458 AAGCATCTTTATTTTTGGTCTGG - Intergenic
901786015 1:11625444-11625466 ATGCACCTTGATTTTGGCCCAGG + Intergenic
902271530 1:15308506-15308528 ATTCAGATTGAGTTTTGGCTGGG - Intronic
902899987 1:19508215-19508237 AATCATAATCATTTTTGGCCAGG - Intergenic
903933805 1:26880604-26880626 ATAAAAATTTATTTTTGGCCAGG - Intronic
904339095 1:29821812-29821834 ATGCAAATGGATTTTTTACCTGG + Intergenic
905005331 1:34705150-34705172 AACCATTTAGATTTTTGGCCAGG - Intergenic
909095475 1:71281912-71281934 AAGAATAATAATTTTTGGCCGGG - Intergenic
909943860 1:81640722-81640744 CTTCATTTTGATTTTTAGCCTGG - Intronic
910523598 1:88152087-88152109 ATGCATATCTATTTTTGTCTGGG - Intergenic
914409407 1:147411411-147411433 ATCCTTTTAGATTTTTGGCCAGG + Intergenic
916378191 1:164179036-164179058 TTGCAATTTCATTTTTGGCCTGG - Intergenic
917116342 1:171607778-171607800 TTCCATATTTATCTTTGGCCAGG + Intergenic
917885205 1:179377459-179377481 ATGCCTATTGTTTTCTGTCCTGG + Intronic
918895333 1:190336573-190336595 ATACATAGTGATATTTGTCCTGG - Intronic
921022429 1:211248504-211248526 AAACATTTTTATTTTTGGCCAGG + Intergenic
921298562 1:213727672-213727694 ATGCACATGTATTTCTGGCCTGG - Intergenic
923723920 1:236490167-236490189 ATTAATATTAATTCTTGGCCAGG + Intergenic
924174368 1:241374907-241374929 TGGCCAATTGATTTTTGGCCAGG + Intergenic
1062808392 10:442410-442432 TCACATATTGATTTTTGACCTGG - Intronic
1064469954 10:15626050-15626072 ATGCAAATGGAGTTTTTGCCTGG - Intronic
1064750396 10:18522513-18522535 ATTTATATTGACTTTTGGCAGGG + Intronic
1064780025 10:18825636-18825658 ATACATATTTATTTTTTGACTGG - Intergenic
1065812794 10:29458165-29458187 ATGGATATATATTTTTGGACTGG - Exonic
1065958886 10:30717326-30717348 ATGGATATATATTTTTGGACTGG + Intergenic
1066480770 10:35793779-35793801 ATCCATTTTAAATTTTGGCCAGG + Intergenic
1067399871 10:45961830-45961852 ATTCACATTGGTTTTTGTCCAGG + Intergenic
1067868199 10:49931121-49931143 ATTCACATTGGTTTTTGTCCAGG + Intronic
1068482159 10:57605520-57605542 ATTAAGATTCATTTTTGGCCGGG + Intergenic
1069758636 10:70791856-70791878 TTGCATAATGAGTTTTGGCATGG + Intergenic
1070544375 10:77441116-77441138 TTGAATTTTGATTCTTGGCCGGG - Intronic
1071792109 10:88965870-88965892 AGGAATATTTATTTTTGGCAGGG - Intronic
1072074425 10:91954851-91954873 AAGAATATACATTTTTGGCCAGG - Intronic
1077888624 11:6403613-6403635 AGGCCTGTTGATTTTGGGCCAGG - Intronic
1079914210 11:26348402-26348424 ATGCTTATGGAGTTCTGGCCTGG + Intronic
1081082156 11:38755849-38755871 AAGTATTTTTATTTTTGGCCAGG + Intergenic
1084130044 11:67126410-67126432 ACACAGATTGTTTTTTGGCCGGG + Intronic
1085751171 11:79162526-79162548 ATTAATTTTGATTTTAGGCCAGG + Intronic
1085803228 11:79611084-79611106 ATGCATGTGTATGTTTGGCCGGG - Intergenic
1088227732 11:107640007-107640029 ATGCATATTTATTTTGAGACAGG + Intronic
1088942026 11:114468866-114468888 ATGCATATTTCCCTTTGGCCTGG - Intergenic
1091128308 11:133121993-133122015 AAGCATATTGATGTAGGGCCTGG + Intronic
1093474489 12:19539600-19539622 ATGCACACTGTTTTTTCGCCTGG - Intronic
1093732874 12:22586086-22586108 ATTCTTAGTCATTTTTGGCCGGG - Intergenic
1094331654 12:29300878-29300900 AAGGATATGCATTTTTGGCCCGG + Intronic
1095267278 12:40175051-40175073 ATACATATTGATTGTTGGGTAGG + Intergenic
1096265389 12:50118471-50118493 ATAAATATGTATTTTTGGCCAGG + Intronic
1097215885 12:57412708-57412730 ATGAAAATGTATTTTTGGCCAGG + Intronic
1099041820 12:77665026-77665048 ATCAATATTTATTTTTAGCCAGG - Intergenic
1099161231 12:79244178-79244200 AAGCATCTTAATTTTTGGCCAGG - Intronic
1100020630 12:90065217-90065239 TTGCAAATTGATTTTTGTCTTGG + Intergenic
1101944847 12:109128970-109128992 TTGCTTATTTATTTGTGGCCTGG + Intronic
1103050774 12:117777732-117777754 ATAAATATTAATTTTTGGCCAGG + Intronic
1103830223 12:123773298-123773320 ATGGTGATTGATTTTTGGTCAGG + Intronic
1104036849 12:125103691-125103713 AAGAATCTTCATTTTTGGCCAGG + Intronic
1105227458 13:18449582-18449604 ATACATATTGATCTTTGTGCTGG + Intergenic
1105923123 13:24983489-24983511 ATGCGTATTGGATTTTGTCCAGG + Intergenic
1109284122 13:60392105-60392127 TTGCATATTGATTGTTGGGTAGG + Intergenic
1109623288 13:64939943-64939965 ATGTATATTTATGTTTGCCCTGG - Intergenic
1109923248 13:69098990-69099012 ATACATATATATTTTTGGCTTGG + Intergenic
1111006012 13:82249971-82249993 ATGCCTATTGATTTATGGGGAGG + Intergenic
1111351723 13:87039664-87039686 TTGCATATTGAATTTTGTCATGG + Intergenic
1113249731 13:108438797-108438819 ATGCATATTTATTTTTGGCTTGG + Intergenic
1113838367 13:113344416-113344438 CTGCAAAAAGATTTTTGGCCAGG + Intronic
1114011911 14:18378036-18378058 ATACATATTGATCTTTGTGCTGG + Intergenic
1114108200 14:19448355-19448377 ATGCATGTTTTTTTATGGCCAGG - Intergenic
1114185604 14:20399539-20399561 ATTTATATTTATTTTTGGCTGGG + Intronic
1115230208 14:31152483-31152505 AAGAATATTGGGTTTTGGCCAGG - Intronic
1115583364 14:34784811-34784833 TTCCATATTTTTTTTTGGCCAGG - Intronic
1115796384 14:36941578-36941600 ATGCATATTTAATTATGGCATGG + Intronic
1115994051 14:39177087-39177109 ATTTAAATTAATTTTTGGCCAGG + Intronic
1116051541 14:39809686-39809708 ATGCATATTGGTGTTTGTCAGGG + Intergenic
1116584814 14:46689594-46689616 ATACATATTTATTTTTGACAAGG + Intergenic
1117337814 14:54769684-54769706 AAGCAGATTGATTTTTGGAGTGG + Intronic
1119785993 14:77314744-77314766 ATCCATATTGCCTTTTGGCAGGG - Intronic
1120327850 14:83052348-83052370 AGGCACATTGATTTTGGCCCAGG - Intergenic
1120825016 14:88946975-88946997 AAGTGTATTTATTTTTGGCCAGG + Intergenic
1121073544 14:91047263-91047285 ATGCATATTGAGTCTTATCCTGG - Intronic
1124593405 15:31073291-31073313 TGGCAAATTGATTTTTGGCAAGG - Intronic
1125049959 15:35285103-35285125 ATGTATATACATTTTAGGCCAGG - Intronic
1125099040 15:35889073-35889095 ATGGAGATTAATTTTTGGACTGG - Intergenic
1127133306 15:55891272-55891294 ATGCATATTGACTTTTAGTTTGG - Intronic
1129771800 15:78207624-78207646 ATGCCTTGGGATTTTTGGCCTGG - Intronic
1129946438 15:79542902-79542924 CTGCATATCGTTTTGTGGCCTGG + Intergenic
1130789318 15:87135247-87135269 ATGCAAAATGATTTATGGTCTGG + Intergenic
1131433745 15:92406698-92406720 ATGAATAATGATTCTTGGCCAGG + Intronic
1131740766 15:95388486-95388508 AAGTATTTTGATTTTCGGCCGGG - Intergenic
1132922445 16:2405041-2405063 AGGAATATTGGTTTGTGGCCGGG + Intergenic
1135971103 16:27072600-27072622 ATGCATATTGTTTATGTGCCTGG + Intergenic
1136296406 16:29306205-29306227 ATGAAAATTAATTTTTGGCATGG + Intergenic
1140851300 16:78937173-78937195 ATACATATGGATTTTTGGAGAGG + Intronic
1141315546 16:82959308-82959330 CTGCATGGTGATTTTTGGCAGGG + Intronic
1142058001 16:88012350-88012372 ATGAAAATTAATTTTTGGCGTGG + Intronic
1143330257 17:6129492-6129514 ATAAATATAGCTTTTTGGCCAGG - Intergenic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1148817534 17:50340742-50340764 ATCCATTTTGATTTTTAGTCTGG - Intergenic
1149102756 17:52925958-52925980 ATGCATAGTGAGTACTGGCCTGG + Intergenic
1149125885 17:53232264-53232286 ATTCATATAAATTTTTGGTCTGG - Intergenic
1150559229 17:66280696-66280718 AAGAATATTAATTTTTGGCCAGG - Intergenic
1150981502 17:70147372-70147394 ATGAAGATTCAGTTTTGGCCAGG + Intergenic
1153714526 18:7833436-7833458 ATGCATATTGATTTTTGGCCAGG + Intronic
1153774595 18:8441492-8441514 AATTATATTGATTTTTGGCTGGG - Intergenic
1154525918 18:15289895-15289917 ATACATATTGATCTTTGTGCTGG - Intergenic
1155281427 18:24244483-24244505 ATGTATGTTGATTTTTGTCATGG - Intronic
1155486955 18:26354687-26354709 CGGCCAATTGATTTTTGGCCAGG - Intronic
1158083595 18:53624432-53624454 ATTCATAGTTAGTTTTGGCCAGG + Intergenic
1160154212 18:76421090-76421112 ATGCATGTTGATCTTTGAGCAGG - Intronic
1162329346 19:10017939-10017961 AAAAAAATTGATTTTTGGCCAGG - Intronic
1164087211 19:21913765-21913787 ATGCATATGGGTTCTTTGCCTGG - Intergenic
1167316905 19:48769105-48769127 ATACAGATTGGTTTTCGGCCAGG - Intergenic
1168154900 19:54467816-54467838 TTTCATATTGAATTTAGGCCGGG - Intronic
926254463 2:11178195-11178217 ATTCATGTTCATTTTTGTCCTGG - Exonic
927346212 2:22044755-22044777 ATACTTAATGATTTTTGGTCTGG - Intergenic
928452848 2:31393180-31393202 GTCCTTACTGATTTTTGGCCTGG + Intronic
928684473 2:33733781-33733803 ATGCATTTTCATTATGGGCCGGG + Intergenic
933214654 2:79616292-79616314 ATGCATAATGATTTTAGGATTGG - Intronic
933674832 2:85045440-85045462 ATGCAGATTAATTTTTTGGCTGG - Intronic
933826334 2:86164392-86164414 ATGTATACTGATTTGGGGCCAGG + Intronic
936101170 2:109581011-109581033 ATGCATATTATTCTTTAGCCAGG - Intronic
936138439 2:109917649-109917671 GTGCATAAAGATTCTTGGCCGGG + Intergenic
936206257 2:110453836-110453858 GTGCATAAAGATTCTTGGCCGGG - Intronic
938470367 2:131554149-131554171 ATGCATGTTTTTTTATGGCCAGG + Intergenic
938525022 2:132121259-132121281 ATACATATTGATCTTTGTGCTGG - Intergenic
939727511 2:145741158-145741180 ATGCAGATTGACATTGGGCCAGG - Intergenic
941222402 2:162799566-162799588 ATGAATATTGTTTTTTGAACAGG - Intronic
941637423 2:167950160-167950182 CTGCATATTGGTGTTAGGCCAGG + Intergenic
1170806465 20:19636739-19636761 ATACATATGGATTAGTGGCCAGG - Intronic
1172314573 20:33943803-33943825 TTGCATATTGAGGTGTGGCCAGG - Intergenic
1173432114 20:42997573-42997595 ATGCATATTCATTTTCGGCAGGG - Intronic
1173892894 20:46527024-46527046 ATAGATATTGATTTGGGGCCAGG - Intergenic
1174249753 20:49209751-49209773 ATACATAATGATAATTGGCCAGG + Intergenic
1174635809 20:51998511-51998533 ATAAATATTTATTATTGGCCGGG + Intergenic
1176217866 20:63956702-63956724 ATGTTTATTGATTTTTTTCCAGG - Exonic
1176523210 21:7841359-7841381 ATGCATATTGTTTATTGGTTGGG - Intergenic
1176771504 21:13078590-13078612 ATACATATTGATCTTTGTGCTGG + Intergenic
1178657230 21:34471371-34471393 ATGCATATTGTTTATTGGTTGGG - Intergenic
1179341655 21:40516526-40516548 ATGCCCAGTTATTTTTGGCCAGG + Intronic
1180436403 22:15308844-15308866 ATACATATTGATCTTTGTGCTGG + Intergenic
1180472825 22:15675953-15675975 ATGCATGTTTTTTTATGGCCAGG + Intergenic
1180518640 22:16173039-16173061 ATACATATTGATCTTTGTGCTGG + Intergenic
1182505397 22:30778738-30778760 ATTCAAACTGATTTATGGCCGGG + Intronic
1183684215 22:39352064-39352086 ATGCTTAGTGACTTTGGGCCAGG - Intronic
951652015 3:24961304-24961326 TTGCATATTTATTCTTGGTCTGG - Intergenic
951742988 3:25944549-25944571 ATGCAAATTGGGTTTTTGCCTGG + Intergenic
952029370 3:29122754-29122776 ATACATATTGTATTTTGGCATGG - Intergenic
952877020 3:37954638-37954660 CTGCATATTTACTTTTGACCTGG + Intronic
957918393 3:86716119-86716141 ATGTGTATTGATTTTTGGTATGG + Intergenic
958000907 3:87747851-87747873 AGACTTAATGATTTTTGGCCTGG + Intergenic
960214230 3:115010731-115010753 ATGCTTATAGATGTTTGTCCAGG - Intronic
962230069 3:133657181-133657203 ATAAATATTTATTTTTAGCCAGG + Intronic
963082893 3:141410697-141410719 AAGCAAATTTATTTTTGACCTGG + Intronic
963667144 3:148202411-148202433 ATACAGTTTTATTTTTGGCCAGG - Intergenic
963813766 3:149807479-149807501 TTCCTTATTGATTTTTGGTCTGG + Intronic
963881860 3:150537441-150537463 CTTCATATTGATATTTGGCTTGG - Intergenic
964897532 3:161615881-161615903 ATTGATATAGATTTTGGGCCTGG - Intergenic
965113564 3:164458421-164458443 AAGCATATTCAGTCTTGGCCGGG + Intergenic
965518425 3:169647548-169647570 ATGCATATTTTTTTTTGGTGTGG - Intronic
967271423 3:187736663-187736685 ATGTACATTTGTTTTTGGCCAGG - Intronic
968750045 4:2384074-2384096 AGGCAGAGTGATTTTTGGACTGG + Intronic
972033064 4:34486885-34486907 ATTCATTTAGATTTTGGGCCTGG + Intergenic
973695082 4:53482946-53482968 ATGTACATTGATATTTGGACAGG + Intronic
976853720 4:89578560-89578582 AGGTATACTGATTTTTGGCCTGG + Intergenic
977107300 4:92903563-92903585 ATGAATAATTATTTTTGGCTAGG + Intronic
977165970 4:93697531-93697553 ATGATAATTGATTTTTGGCATGG - Intronic
978786657 4:112616957-112616979 ATTCTTATTCATTTTTGGACAGG - Intronic
979443639 4:120783305-120783327 ATGCATCGTGACATTTGGCCAGG - Intronic
979471592 4:121104724-121104746 CTGCTTATTGATTTTCTGCCTGG + Intergenic
980867348 4:138568383-138568405 ATGCAGACTGATTTTTGCCTAGG - Intergenic
981803461 4:148684887-148684909 ATGAATATTTATTTTGTGCCAGG + Intergenic
983258869 4:165433363-165433385 CTCCATTTTGATTTTTAGCCTGG + Intronic
983361135 4:166724834-166724856 AGGCAGATTGATTTTAGCCCTGG - Intergenic
983768983 4:171524405-171524427 ATGAATATTGTTTTCTGCCCAGG + Intergenic
987977080 5:25028449-25028471 AAGAAAATAGATTTTTGGCCAGG + Intergenic
989008912 5:36847415-36847437 ATTAATAATTATTTTTGGCCAGG - Intergenic
989228601 5:39060547-39060569 ATGAATATTGATTTTTGTGTTGG - Intronic
990475159 5:56155584-56155606 CTCCATTTTGATATTTGGCCTGG + Intronic
993986958 5:94608627-94608649 ATTAATACTAATTTTTGGCCAGG - Intronic
994255652 5:97592104-97592126 GTGCTTATTGATTTTTTGCCTGG + Intergenic
994447215 5:99892006-99892028 ATGCAGTTTGATTTTTCCCCAGG - Intergenic
997063974 5:130541570-130541592 ATGCAAAGTGATTGCTGGCCAGG + Intergenic
997127532 5:131243282-131243304 ATTCTTAATAATTTTTGGCCGGG + Intergenic
1001616093 5:173044847-173044869 CTCCATTTTGATTTTTAGCCTGG + Intergenic
1002528165 5:179826874-179826896 AAGAATACTGATTCTTGGCCGGG - Intronic
1003400043 6:5783564-5783586 ATGCGTTTTGGTTTTTGTCCAGG + Intergenic
1003435273 6:6082333-6082355 ATACTTAATGTTTTTTGGCCAGG + Intergenic
1003664892 6:8101940-8101962 AGGCAGCTTGCTTTTTGGCCAGG - Intronic
1005146325 6:22694406-22694428 ATGAATTTTAATTTTTGGCCAGG - Intergenic
1007565521 6:42847480-42847502 AAAAGTATTGATTTTTGGCCAGG + Intronic
1010152106 6:72744948-72744970 ATGGATATGGATTTATGGACAGG + Intronic
1010226368 6:73493288-73493310 AAAAATATTTATTTTTGGCCAGG - Intronic
1010757379 6:79682168-79682190 TTGCATATTGATTTTAGTGCCGG - Intronic
1011208368 6:84926781-84926803 TTACACATTGATTTTTGGCATGG + Intergenic
1011691476 6:89873455-89873477 ATGGTTTTAGATTTTTGGCCAGG - Intronic
1014690964 6:124563197-124563219 ATGCAAAACTATTTTTGGCCGGG - Intronic
1015831932 6:137379339-137379361 AAGAAAACTGATTTTTGGCCAGG + Intergenic
1016192331 6:141286037-141286059 AAGGATATTGATTTTCTGCCTGG + Intergenic
1017314243 6:153012178-153012200 ATGCATGTTAATTTTTGCCAGGG - Intronic
1026554326 7:71392696-71392718 ATGGATATTGATTTATGGTCTGG - Intronic
1028634568 7:92972670-92972692 ATCCATATTTATTTTTGGTAGGG + Intergenic
1029049411 7:97668975-97668997 ATGCAAATTAATTTGGGGCCTGG - Intergenic
1031962624 7:128003708-128003730 TTGGATATGGATTTTTGGCCTGG + Intronic
1032329869 7:130968079-130968101 ATGCATCTTGATTTGTGGGTTGG - Intergenic
1034836699 7:154358999-154359021 AAGAATATTGTTTCTTGGCCAGG - Intronic
1036999376 8:13699301-13699323 CTGCATTTTGTTTTTTGACCTGG - Intergenic
1037077956 8:14745363-14745385 ATACATATTGATCTGTTGCCAGG + Intronic
1037117375 8:15242925-15242947 ATAAATAATGGTTTTTGGCCGGG - Intergenic
1037519891 8:19670324-19670346 ATACAGATTGATTTTTGGGAAGG - Intronic
1038581268 8:28751289-28751311 ATACATATATATTTTTGGCTGGG + Exonic
1039055291 8:33531476-33531498 ATGAATCAAGATTTTTGGCCGGG - Intergenic
1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG + Intronic
1040639695 8:49319126-49319148 ATACATATCTATTTTTGGCCGGG - Intergenic
1040728727 8:50416173-50416195 ATGGATATTGGTTTTTGCACTGG + Intronic
1042601161 8:70501178-70501200 ATACATATTGATGCTGGGCCTGG - Intergenic
1043118383 8:76289040-76289062 ATTCATATTTATTTTTGAACGGG + Intergenic
1043795290 8:84529828-84529850 ATGCATATTTATTATTTGCCTGG - Intronic
1044490748 8:92811369-92811391 ATGCATATTTTATTTTTGCCTGG - Intergenic
1044517171 8:93153266-93153288 ATGCATTTTTTTTTTTGGCTAGG - Intronic
1045838850 8:106556115-106556137 ATGCATATTGATGGTTGCCAGGG + Intronic
1046838606 8:118830834-118830856 AATGCTATTGATTTTTGGCCAGG - Intergenic
1048383917 8:133893473-133893495 CTGCATAATGATTTGTGCCCAGG - Intergenic
1050432659 9:5577624-5577646 TTACACATTGATTTTTGGCATGG - Intergenic
1053232028 9:36418329-36418351 TTACATATTGATTGTTGGCCAGG - Intronic
1053703739 9:40728711-40728733 ATACATATTGATCTTTGTGCTGG - Intergenic
1054413821 9:64852320-64852342 ATACATATTGATCTTTGTGCTGG - Intergenic
1056313180 9:85362893-85362915 GTACATATGGAGTTTTGGCCAGG - Intergenic
1056410443 9:86321055-86321077 TTGAATTTTAATTTTTGGCCGGG + Intronic
1059485703 9:114625025-114625047 AAGCATAGTGATTTGAGGCCAGG + Intronic
1060472952 9:123963914-123963936 ATATATAATGATATTTGGCCAGG + Intergenic
1060693311 9:125684409-125684431 ATTCATATTGATATTTGGGGAGG - Intronic
1060774502 9:126362889-126362911 AGGAAAATTAATTTTTGGCCAGG + Intronic
1186101427 X:6160814-6160836 ATTAAAATTTATTTTTGGCCAGG - Intronic
1188426791 X:30057595-30057617 ATGTTTCTTGATTTTTGGTCTGG + Intergenic
1189823780 X:44896370-44896392 AAGAAAATTTATTTTTGGCCGGG - Intronic
1193595539 X:83440277-83440299 GTCAATATTTATTTTTGGCCGGG + Intergenic
1194078837 X:89432730-89432752 TTGCAGATTGATTTTTAGGCAGG + Intergenic
1194105853 X:89766541-89766563 ATGGAAATTGCTTTTTGACCAGG + Intergenic
1194152206 X:90339747-90339769 ATGCACACTGATTTTGGCCCAGG + Intergenic
1194237947 X:91407975-91407997 AGGCATATCAACTTTTGGCCGGG - Intergenic
1196377555 X:115050764-115050786 ATTAATATTTATTTTTGGCTGGG - Intergenic
1196415564 X:115467323-115467345 ATATATATTGATTACTGGCCAGG - Intergenic
1198271810 X:135062455-135062477 AGGCACATTGATTTTGGCCCAGG - Intergenic
1198332810 X:135637341-135637363 AAATATATGGATTTTTGGCCAGG + Intergenic
1198866368 X:141127728-141127750 ATGCACATTGTATTTTGGCTGGG + Intergenic
1199353156 X:146828772-146828794 ATCCATACTGAATTTTGGCCAGG - Intergenic
1200431461 Y:3088053-3088075 TTGCAGATTGATTTTTAGGCAGG + Intergenic
1200457814 Y:3414400-3414422 ATGGAAATTGCTTTTTGACCAGG + Intergenic
1200498554 Y:3916499-3916521 ATGCACACTGATTTTGGCCCAGG + Intergenic
1201071290 Y:10149393-10149415 ATGGATAGTGTTCTTTGGCCTGG - Intergenic
1201620266 Y:15949096-15949118 AAGCCTATTGATGTTTGACCAGG + Intergenic
1202337574 Y:23827455-23827477 AAGCATATTGTTTTTTCTCCAGG - Intergenic
1202533192 Y:25842616-25842638 AAGCATATTGTTTTTTCTCCAGG + Intergenic