ID: 1153721229

View in Genome Browser
Species Human (GRCh38)
Location 18:7905560-7905582
Sequence GCTGCAGAAGACTCCACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153721229_1153721237 28 Left 1153721229 18:7905560-7905582 CCTGAAGTGGAGTCTTCTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1153721237 18:7905611-7905633 GGTCCCAATTCTCCCCTTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 102
1153721229_1153721233 3 Left 1153721229 18:7905560-7905582 CCTGAAGTGGAGTCTTCTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1153721233 18:7905586-7905608 GCCACAGCTGACCTTTGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 245
1153721229_1153721235 7 Left 1153721229 18:7905560-7905582 CCTGAAGTGGAGTCTTCTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1153721235 18:7905590-7905612 CAGCTGACCTTTGTGGCGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1153721229_1153721232 0 Left 1153721229 18:7905560-7905582 CCTGAAGTGGAGTCTTCTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1153721232 18:7905583-7905605 CTGGCCACAGCTGACCTTTGTGG 0: 1
1: 1
2: 1
3: 33
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153721229 Original CRISPR GCTGCAGAAGACTCCACTTC AGG (reversed) Intronic
900947957 1:5841833-5841855 GCTGCTGAGGACTCCACCACCGG - Intergenic
901302078 1:8207063-8207085 GCAGCAGAAGTCTCTGCTTCTGG - Intergenic
901786110 1:11626035-11626057 ACTGCAGGAGTCTCCCCTTCAGG + Intergenic
901960050 1:12819215-12819237 GCCTCTGTAGACTCCACTTCTGG - Intergenic
902713384 1:18255868-18255890 GCTGCACAAGCCTGCACCTCTGG - Intronic
902747226 1:18482064-18482086 TCTGCAGAAGGCTCTCCTTCCGG - Exonic
904940312 1:34161446-34161468 GCTGCAGGACACTATACTTCAGG + Intronic
905962887 1:42059777-42059799 GCCTCTGTAGACTCCACTTCTGG + Intergenic
910974488 1:92892056-92892078 GCCTCTGTAGACTCCACTTCTGG + Intronic
911323120 1:96439056-96439078 GCCTCTGTAGACTCCACTTCTGG - Intergenic
912575958 1:110673530-110673552 GAGGCAGACGACCCCACTTCAGG - Exonic
916460764 1:165022010-165022032 GCTTCTGTAGACTCCACCTCTGG - Intergenic
917316017 1:173726295-173726317 GCCTCAGTAGACTCCACCTCTGG + Intronic
917698618 1:177556374-177556396 GTTACAGAACACCCCACTTCTGG + Intergenic
920313034 1:205059534-205059556 GATGCAGATGACTCCAGGTCAGG - Intronic
921046083 1:211478995-211479017 CCTGCAGAAGGCTCCGCTTCTGG + Exonic
924950134 1:248874444-248874466 ACTGCAGTAGAGTCCATTTCAGG - Intergenic
1063464833 10:6236371-6236393 GCTGCAGAAGGAACCACTCCAGG - Intergenic
1064027364 10:11859636-11859658 CCTGCAGGAGCCTCCACTGCGGG + Intronic
1065019103 10:21488000-21488022 GATGGAGAAGATTCCACTTCTGG + Intergenic
1066516273 10:36164085-36164107 CCTTCAGAAGACTGCAGTTCTGG + Intergenic
1068552585 10:58423323-58423345 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1069819520 10:71218678-71218700 ACTGCAGAAGACTCCAGGTCTGG - Intronic
1072527309 10:96284606-96284628 GCTGCAGAGCATTCCACTTACGG - Intergenic
1074122389 10:110502302-110502324 GCTGGGGAAGAAGCCACTTCAGG + Intronic
1075214472 10:120520159-120520181 GCTGCAGGAGGCTCGACTTCAGG + Intronic
1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG + Intergenic
1077884736 11:6378678-6378700 CCTACAGAAGACTCCAGCTCAGG - Intergenic
1081061581 11:38484997-38485019 GCTGCAGAAGACAGAACTTTAGG + Intergenic
1082144410 11:48649438-48649460 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1083124511 11:60550904-60550926 GCCTCTGTAGACTCCACTTCTGG + Intergenic
1086422509 11:86651143-86651165 GCCTCTGTAGACTCCACTTCTGG + Intronic
1086923808 11:92618075-92618097 GCTTCTGCAGACTCCACCTCTGG - Intronic
1087249116 11:95876192-95876214 GCCTCTGAAGACTCCACCTCTGG - Intronic
1087916765 11:103820399-103820421 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1087993826 11:104779196-104779218 GCTGCAGACGACTTCATTTTAGG + Intergenic
1090188093 11:124751452-124751474 GCTGCACAAAGCTCCACTCCAGG + Exonic
1090378234 11:126306617-126306639 CCTGGAGAAGACGCCATTTCAGG + Exonic
1091319999 11:134642684-134642706 GATGCAGAAGACAACATTTCAGG - Intergenic
1092711248 12:11340017-11340039 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1094707871 12:32932312-32932334 GCTGCAGAAGACTCTTCCTCAGG + Intergenic
1094792258 12:33928796-33928818 GCTTCTGTAGACTCCACCTCTGG + Intergenic
1095783840 12:46088879-46088901 CCTGGAGAAGACTTCACTTGTGG - Intergenic
1096007231 12:48183373-48183395 GCTGCAGAAACCTCCAAGTCCGG - Intergenic
1096489579 12:52006508-52006530 GCTGCAGGAGACTCCAGGGCAGG - Intergenic
1096625508 12:52893142-52893164 GCTGCATAATATTCCACTTTGGG - Intergenic
1098642607 12:72857019-72857041 GCTTCAGGAGACTCCACCTCTGG - Intergenic
1099114623 12:78609017-78609039 GCCTCAGTAGACTCCACCTCTGG + Intergenic
1101361841 12:104034684-104034706 GCCTCTGTAGACTCCACTTCTGG + Intronic
1102829362 12:115982472-115982494 GCAGAGGAGGACTCCACTTCTGG - Exonic
1104991193 12:132624705-132624727 GCTGCAGAAGAACCCACAGCTGG - Exonic
1105639731 13:22249933-22249955 GCTGCAGATGGCCCGACTTCAGG + Intergenic
1105789101 13:23780003-23780025 GCCTCAGTAGACTCCACCTCTGG + Intronic
1106188289 13:27427619-27427641 GGTGCAGAAGAGTCCTCTTTAGG + Intronic
1109806668 13:67452808-67452830 GCCTCTGTAGACTCCACTTCCGG + Intergenic
1113809684 13:113130695-113130717 GCTGCAGGTGACTGCACTCCGGG - Intronic
1114233651 14:20805381-20805403 GCTGCCCAAGACGACACTTCTGG - Intergenic
1114501434 14:23171937-23171959 ACTGCAGAACACTGCTCTTCTGG + Intronic
1116944297 14:50821891-50821913 GCTGCAGCAGACATTACTTCAGG - Exonic
1118443382 14:65831338-65831360 GCTGCAGAAGGCTCCACCAAGGG - Intergenic
1118701108 14:68434336-68434358 GCTTCTGTAGACTCCACCTCTGG - Intronic
1119587637 14:75851582-75851604 GCTGCAGAATGCTCTAATTCTGG - Intronic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1120470502 14:84917965-84917987 GCAGCAGCAGACACCACCTCTGG - Intergenic
1120742908 14:88127823-88127845 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1120961538 14:90129513-90129535 GCTGCTCCAGACTCCACTTTGGG + Intronic
1127908913 15:63399638-63399660 GCTGAAGATAACACCACTTCTGG - Intergenic
1130432372 15:83861187-83861209 GCCTCTGTAGACTCCACTTCTGG + Intronic
1130788991 15:87132155-87132177 GCTGCAAAGGACATCACTTCAGG - Intergenic
1131195110 15:90349299-90349321 GCTGCAGAAATGTCCGCTTCCGG + Intergenic
1131578280 15:93614213-93614235 GCTGATAAAGACTCAACTTCTGG + Intergenic
1131596263 15:93801220-93801242 TGTGCAGAAGACTCTTCTTCTGG - Intergenic
1132005546 15:98223294-98223316 GCTGAAGGAGTCTCCACTCCAGG - Intergenic
1132109520 15:99092293-99092315 GCTGCTGATGACTAAACTTCGGG + Intergenic
1132455651 16:20749-20771 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1133949909 16:10382596-10382618 TCTGCAGAAGAATCTGCTTCTGG + Intronic
1137335691 16:47546708-47546730 GCTTCTGTAGACTCCACTTGTGG - Intronic
1139202529 16:64992983-64993005 GATGCAGATGACCCCACTTATGG - Exonic
1139545037 16:67646059-67646081 GCTGCAGGAGACACCCCCTCAGG + Exonic
1140963695 16:79942999-79943021 GCTGCATATGACACAACTTCAGG - Intergenic
1141327867 16:83079218-83079240 AGTGCAGAAGACACTACTTCTGG - Intronic
1142251109 16:88992501-88992523 TCTGCAGACAACTCCACATCCGG + Intergenic
1143538804 17:7557674-7557696 GGTCCAGAAGACCCCACTTCAGG + Exonic
1144716089 17:17436885-17436907 GCTGTAGAGGACCCCACTTTAGG + Intergenic
1146712144 17:35051257-35051279 GCTGAAGAAGTCTCCATTTTGGG - Intronic
1146739958 17:35274905-35274927 GCCTCAGTAGACTCCACCTCTGG + Intergenic
1147491332 17:40870208-40870230 GCTGCAGAAGATCCCTCTGCAGG - Intergenic
1148992747 17:51680681-51680703 GATGCAGAAGACTATAGTTCTGG + Intronic
1153721229 18:7905560-7905582 GCTGCAGAAGACTCCACTTCAGG - Intronic
1155435238 18:25805781-25805803 ACTGGGGAAGAATCCACTTCTGG - Intergenic
1157792551 18:50545732-50545754 GCTGGAGACGGCTGCACTTCAGG + Intergenic
1158114453 18:53979287-53979309 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1158449260 18:57548855-57548877 GATGCAGAAAACTCCAATTCAGG - Intronic
1159570355 18:70105090-70105112 GCCTCTGTAGACTCCACTTCTGG - Intronic
1161514751 19:4690172-4690194 CCTCCAGGAGACACCACTTCGGG - Intronic
1164503958 19:28842691-28842713 GCTGCATAATATTTCACTTCGGG - Intergenic
929844659 2:45510619-45510641 GCAAGAGAAGACTCCACTTCAGG + Intronic
929892343 2:45928841-45928863 GCTGCAGAATAGTCTAATTCTGG - Intronic
930467632 2:51774667-51774689 GCTTCTGTAGACTCCACTTCTGG - Intergenic
931043655 2:58325875-58325897 GCCTCAGTAGACTCCACCTCTGG + Intergenic
931888891 2:66648188-66648210 GCCTCTGTAGACTCCACTTCTGG - Intergenic
936231457 2:110704126-110704148 GCTGCCCAAGACCACACTTCTGG - Intergenic
940519734 2:154729165-154729187 ACTGAAGAAGACTTCATTTCTGG - Intronic
942210529 2:173665006-173665028 ACTGCTAAAGACTCCACTTTGGG - Intergenic
943322179 2:186458102-186458124 GCATCAGAGGACTCCACGTCAGG + Intergenic
944165057 2:196710112-196710134 GCTTCTGTAGACTCCACCTCTGG - Intronic
945614968 2:212055346-212055368 GCTTCTGTAGACTCCACCTCTGG + Intronic
948119213 2:235516445-235516467 GCTGCACCAGACTTCACTTGAGG - Intronic
1169092044 20:2866832-2866854 GCTGGAGAAGCCCCCACCTCCGG - Intronic
1170036179 20:11992670-11992692 TCTTCACAAGGCTCCACTTCAGG - Intergenic
1171273661 20:23835974-23835996 GCCGCTGCAGACTCCACCTCCGG + Intergenic
1172398699 20:34630217-34630239 CCTGCAGAAGACCTCAGTTCTGG + Intronic
1175612707 20:60364964-60364986 TCTGGAGAATGCTCCACTTCTGG - Intergenic
1181278373 22:21701686-21701708 GATGCAAAAGACTACACTCCAGG + Intronic
1182165040 22:28164193-28164215 GCTTCTGTAGACTCCACCTCTGG + Intronic
1183002804 22:34875746-34875768 GAAGCAGGAGAGTCCACTTCGGG - Intergenic
1184004228 22:41696951-41696973 GCCGGGGAAGACCCCACTTCAGG - Exonic
1184513862 22:44948379-44948401 ACTGCAGAAAACTCTGCTTCAGG + Intronic
1184633735 22:45808103-45808125 GCCTCAGAAGACTCCTCTGCAGG + Intronic
1184642172 22:45878510-45878532 GCAGCCAAAGACTCCACCTCGGG + Intergenic
1184906386 22:47489187-47489209 GCTGCAGAATCGTCCACCTCTGG - Intergenic
1185427855 22:50783616-50783638 GCCGCAGCGCACTCCACTTCCGG + Exonic
950781548 3:15397076-15397098 GCCTCTGTAGACTCCACTTCTGG - Intronic
953377523 3:42441133-42441155 GAAGCATGAGACTCCACTTCTGG + Intergenic
954316756 3:49805703-49805725 GCTCCTGAAGACTCCTCCTCAGG + Intronic
954627451 3:52030335-52030357 ACTGCAGAAGTCTCCACCACAGG - Intergenic
960198433 3:114800039-114800061 GATACAGTAGACTCCACATCTGG + Intronic
960276775 3:115738094-115738116 GCCTCTGAAGACTCCACCTCTGG - Intergenic
960352178 3:116607188-116607210 GCTGGAGAAGGCTGGACTTCAGG + Intronic
960914686 3:122683238-122683260 GCAGAAGAAGAATGCACTTCTGG - Intronic
961184307 3:124901456-124901478 CTTGCAGAAAACTCAACTTCCGG - Intergenic
962180338 3:133199859-133199881 GCTTCTGTAGACTCCACCTCTGG - Intronic
967843290 3:194024331-194024353 GCTGCAGATGACTGAGCTTCAGG - Intergenic
969690169 4:8699784-8699806 GCTGCAAAGGGCGCCACTTCAGG + Intergenic
970578044 4:17446792-17446814 GCTGCAGAAAAATCCAGCTCGGG - Intergenic
972685636 4:41349978-41350000 GCCTCTGTAGACTCCACTTCTGG + Intergenic
972719261 4:41679371-41679393 GCAGCAGAAGTCACCATTTCTGG - Intronic
974176696 4:58333865-58333887 GCTTCTGTAGACTCCACCTCTGG + Intergenic
974383985 4:61180911-61180933 GCTGTAGAGGACCTCACTTCTGG + Intergenic
974547704 4:63334134-63334156 GCCTCTGAAGACTCCACCTCTGG + Intergenic
974959788 4:68683122-68683144 GCTTCTGTAGACTCCACCTCTGG - Intergenic
976778626 4:88734294-88734316 GCTGCTGTAGACTGCCCTTCAGG - Intronic
977478005 4:97537593-97537615 GCTTCTGTAGACTCCACCTCTGG + Intronic
980231505 4:130051789-130051811 GCCTCAGTAGACTCCACCTCTGG - Intergenic
981149834 4:141368302-141368324 GCCACTGTAGACTCCACTTCTGG - Intergenic
983648929 4:170019672-170019694 GCTCCAGAATTGTCCACTTCTGG - Intronic
983668329 4:170207620-170207642 GCTTCTGTAGACTCCACCTCTGG + Intergenic
983829043 4:172301961-172301983 GCCTCAGTAGACTCCACCTCTGG - Intronic
985731035 5:1549061-1549083 GCTGCGGAAGACTCCAGGGCAGG - Intergenic
986015664 5:3754861-3754883 GATGCAGATGACTCCCCTTGAGG - Intergenic
986520152 5:8606764-8606786 ACTGCAGAAGACTGCAGTTTTGG + Intergenic
989248554 5:39281331-39281353 GCTTCTGTAGACTCCACCTCTGG - Intergenic
989843602 5:46111802-46111824 GCATCAGTAGACTCCACCTCTGG - Intergenic
990095137 5:52102388-52102410 GCCTCTGAAGACTCCACCTCTGG - Intergenic
992973160 5:82083379-82083401 GCCTCTGTAGACTCCACTTCTGG + Intronic
995950229 5:117703464-117703486 GCTTCCAAAGATTCCACTTCTGG - Intergenic
996356095 5:122598119-122598141 GCCTCAGTAGACTCCACCTCTGG - Intergenic
996360095 5:122636378-122636400 GCCTCAGTAGACTCCACCTCTGG - Intergenic
996782008 5:127197660-127197682 GCTTCTGTAGACTCCACCTCTGG + Intergenic
997808828 5:136947022-136947044 GCCCCTGTAGACTCCACTTCTGG - Intergenic
1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG + Intergenic
1005981323 6:30839248-30839270 GCTTCAGGACTCTCCACTTCAGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007627958 6:43257137-43257159 TCCCCAGAACACTCCACTTCTGG - Intronic
1009453634 6:63829611-63829633 GCCTCTGTAGACTCCACTTCTGG + Intronic
1009998692 6:70925694-70925716 GCCTCTGTAGACTCCACTTCTGG + Intronic
1010851568 6:80783568-80783590 GCTTCTGTAGACTCCACCTCTGG + Intergenic
1011012287 6:82715749-82715771 GCCTCTGTAGACTCCACTTCTGG + Intergenic
1012933265 6:105338932-105338954 GCTTCTGTAGACTCCACCTCTGG + Intronic
1013980633 6:116123519-116123541 GCTGCAGAGGATTCCACAGCTGG - Intronic
1014049018 6:116930002-116930024 GAAGCAGAAAATTCCACTTCAGG + Intronic
1014765029 6:125396449-125396471 GCTTCTGTAGACTCCACCTCTGG + Intergenic
1015050113 6:128829999-128830021 GCTTCTGTAGACTCCACCTCTGG + Intergenic
1015517861 6:134102312-134102334 GCAGCAAAGGCCTCCACTTCAGG - Intergenic
1020590826 7:10134572-10134594 ACTGCAAAAGACTCCACATTGGG - Intergenic
1020776028 7:12454942-12454964 CCTGCTAAAGACTCTACTTCAGG + Intergenic
1024235181 7:47392390-47392412 GCTGCAGAGGGCTCCATTCCAGG + Intronic
1024505709 7:50159413-50159435 GTTGCAGAAGATTCCTCTTTAGG + Exonic
1024962631 7:54993755-54993777 GCTTCAGATCACTCCACTCCAGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1026911658 7:74094798-74094820 GCGGCAGGAGACGCCACGTCAGG - Intronic
1028078718 7:86547882-86547904 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1028578500 7:92380276-92380298 GCTTCTGTAGACTCCACCTCTGG + Intronic
1029676496 7:102073024-102073046 GCTGGAAAACACTCCCCTTCTGG - Intronic
1031353712 7:120765427-120765449 ACTGCAGAACACTTCACCTCTGG + Intergenic
1033902288 7:146157783-146157805 GCCTCTGTAGACTCCACTTCTGG + Intronic
1037927503 8:22855547-22855569 TCTGCAGAAGACTTAACCTCAGG - Intronic
1038169597 8:25117047-25117069 GCTGGAGTAGCCTCCTCTTCTGG + Intergenic
1039146326 8:34451331-34451353 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1039438471 8:37578190-37578212 GCTGAGGAAGACTCCATTTGGGG - Intergenic
1039719158 8:40143789-40143811 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1040772294 8:50992075-50992097 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1041669698 8:60479872-60479894 GCTACCGAAGACAGCACTTCTGG + Intergenic
1041750379 8:61254512-61254534 GCCTCTGTAGACTCCACTTCTGG - Intronic
1042698276 8:71582152-71582174 GCTTCTGTAGACTCCACCTCTGG + Intronic
1043279456 8:78445387-78445409 GCTTCTGTAGACTCCACCTCTGG + Intergenic
1043535985 8:81205016-81205038 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1043747814 8:83898295-83898317 GCTTCTGTAGACTCCACCTCTGG + Intergenic
1044546606 8:93466856-93466878 GCCTCTGTAGACTCCACTTCAGG + Intergenic
1044548310 8:93483775-93483797 GCCTCTGTAGACTCCACTTCTGG + Intergenic
1045419557 8:102000428-102000450 GCCTCTGTAGACTCCACTTCTGG + Intronic
1045871010 8:106926980-106927002 GCCTCAGAACACTACACTTCAGG + Intergenic
1047334111 8:123919839-123919861 GGTGCAGAAGAGTCCAAGTCAGG - Intronic
1049336488 8:142089405-142089427 GCTGCTGCAGTCTCCACTGCTGG - Intergenic
1050504750 9:6336383-6336405 GCCTCAGTAGACTCCACCTCTGG + Intergenic
1056444699 9:86654448-86654470 ACTGCAGAAGAAACCAATTCAGG - Intergenic
1059326794 9:113508574-113508596 GCAGCAGGAGACTCACCTTCGGG - Exonic
1059715646 9:116910585-116910607 GCTTCAGGATCCTCCACTTCCGG - Intronic
1188123132 X:26334523-26334545 GCCTCTGTAGACTCCACTTCTGG + Intergenic
1188219772 X:27527117-27527139 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1190621290 X:52288972-52288994 CCTGCAGCAGAAGCCACTTCTGG + Intergenic
1191070356 X:56394327-56394349 GCTTCTGCAGACTCCACCTCTGG - Intergenic
1191122462 X:56920758-56920780 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1191175991 X:57502282-57502304 GCCTCTGTAGACTCCACTTCTGG + Intergenic
1191589896 X:62870809-62870831 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1191704910 X:64084451-64084473 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1191808704 X:65163367-65163389 GCTTCTGTAGGCTCCACTTCTGG - Intergenic
1193787082 X:85772478-85772500 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1193811244 X:86054321-86054343 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1194515975 X:94854666-94854688 GCTGCAGCAAACCCCACTTGAGG + Intergenic
1196759869 X:119191463-119191485 GCTGCAGAAGTCACCTCCTCAGG - Intergenic
1197737104 X:129859237-129859259 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1198302867 X:135348632-135348654 ACTTCAGAAGACTCCTGTTCAGG - Intronic
1201247069 Y:12015216-12015238 GCTTCTGTAGACTCCACCTCTGG - Intergenic
1201936719 Y:19418469-19418491 GCTGCTGTAGGCTCCACCTCCGG - Intergenic
1201971482 Y:19802141-19802163 GCTCCTGTAGACTCCACCTCTGG + Intergenic
1201975021 Y:19839689-19839711 GCCTCTGTAGACTCCACTTCTGG - Intergenic
1202105042 Y:21354949-21354971 GCTTCTGTAGACTCCACCTCTGG + Intergenic