ID: 1153721645

View in Genome Browser
Species Human (GRCh38)
Location 18:7909698-7909720
Sequence TCTCATTTGCTCCACTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153721644_1153721645 1 Left 1153721644 18:7909674-7909696 CCAAATGGCTGCAAAATTGCTGA No data
Right 1153721645 18:7909698-7909720 TCTCATTTGCTCCACTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153721645 Original CRISPR TCTCATTTGCTCCACTGTAA AGG Intronic