ID: 1153721645

View in Genome Browser
Species Human (GRCh38)
Location 18:7909698-7909720
Sequence TCTCATTTGCTCCACTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153721644_1153721645 1 Left 1153721644 18:7909674-7909696 CCAAATGGCTGCAAAATTGCTGA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1153721645 18:7909698-7909720 TCTCATTTGCTCCACTGTAAAGG 0: 1
1: 0
2: 2
3: 18
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153721645 Original CRISPR TCTCATTTGCTCCACTGTAA AGG Intronic
901316097 1:8309966-8309988 TCTCAGTATCTCCTCTGTAAAGG - Intergenic
908034111 1:60033436-60033458 TCAGATTTGTTCCTCTGTAAAGG - Intronic
908989775 1:70072735-70072757 TCCTATTTGCTTAACTGTAAAGG + Intronic
909294989 1:73936202-73936224 TCTCCTTTGCTCCCCTTTACTGG - Intergenic
909302259 1:74028344-74028366 TCTCATTTTCTTCATTGTTAAGG + Intronic
909992640 1:82241382-82241404 TCTCATATGCACCATCGTAAAGG + Intergenic
910139538 1:84012167-84012189 TCTCACTGGCTCCAGTGTGAAGG + Intergenic
910505246 1:87943116-87943138 TCTCATATTCTACACTATAATGG - Intergenic
912493823 1:110078529-110078551 TCACATTTGCTCCTCAGCAAGGG - Intergenic
913813644 1:122933568-122933590 TCTAATCTGCTCCTGTGTAAAGG - Intergenic
913942932 1:125124863-125124885 TCGCATTTGCTTGTCTGTAAAGG - Intergenic
915236870 1:154490010-154490032 TCACTTTTGCACCACTGTAAAGG + Intronic
915762993 1:158334222-158334244 TCTCAATTGCTCCACTTTTCAGG - Intergenic
915999482 1:160601015-160601037 ACTCATTTACTCCACTCTCAGGG - Intergenic
917646920 1:177038314-177038336 TCTCATTTGCTAGACTATAGGGG + Intronic
919035546 1:192303962-192303984 TCTCAGTTTATCCACTGAAATGG - Intergenic
919665441 1:200287107-200287129 ACTCATTTTCTCCACTTTGAGGG - Intergenic
922864074 1:228843702-228843724 TCTCATTTGCTCAAATAGAATGG + Intergenic
1063451902 10:6155587-6155609 TGTCAAGGGCTCCACTGTAAGGG + Intronic
1064492691 10:15876729-15876751 CCTCATTTGCTAGTCTGTAAAGG + Intergenic
1064794344 10:18994369-18994391 TCACATTTGCTTGTCTGTAAAGG - Intergenic
1065144170 10:22750977-22750999 TCTCATTGGCTTCACTTTAAGGG - Intergenic
1065805763 10:29392303-29392325 TCTAATTTCCTGCACTGTTATGG + Intergenic
1068345468 10:55772372-55772394 TCTTATTTTTTCCACTTTAATGG + Intergenic
1069639513 10:69945662-69945684 TCTCCTTTGCTGCCCTGAAATGG - Exonic
1070302792 10:75216856-75216878 TTTCATATGCTCCACAGAAAAGG - Intronic
1074167323 10:110894497-110894519 TTTCATTTGGTCTACAGTAATGG - Exonic
1075993515 10:126858015-126858037 TCTTGTTTGCTCCACTGTAGGGG - Intergenic
1076327381 10:129636390-129636412 TCTCATTTGCATCATTGAAAAGG + Intronic
1078965558 11:16336523-16336545 TCTCACCTGCACCACTGCAATGG + Intronic
1080041569 11:27764650-27764672 TCTCAGTTGCTTGACTGTAAAGG - Intergenic
1085903597 11:80732528-80732550 TCACATTTGATCTACTATAAAGG + Intergenic
1087569574 11:99907699-99907721 ACACATTTTCTCAACTGTAATGG + Intronic
1092054189 12:5495474-5495496 TATGATTTGCTCCAGTGTTATGG + Intronic
1092088748 12:5786735-5786757 ACTGCTTTGCTCCACTTTAAGGG - Intronic
1092849819 12:12616786-12616808 TCCCATTTTCTTCAGTGTAAGGG + Intronic
1093168963 12:15837579-15837601 TCCCATTTGCTCCACAGTTGTGG + Intronic
1095928558 12:47603785-47603807 TCTTATTATCTCCATTGTAAAGG - Intergenic
1098107535 12:67085360-67085382 TATCATTTGAACCTCTGTAATGG + Intergenic
1099088461 12:78276974-78276996 TCACATTAGCTCCACAGCAATGG - Intergenic
1099135645 12:78896409-78896431 TCTCATTTGTTCAACAGAAAAGG - Intronic
1100377629 12:94031981-94032003 TCTCATTTTCCCCTCTGTCAGGG + Intergenic
1102636398 12:114328211-114328233 TGTGACTTGCTCCACTGTGATGG + Intergenic
1106580063 13:31010117-31010139 TCTCAGTTTCCCCACTGTAAAGG + Intergenic
1109244086 13:59931356-59931378 ATTCATTTGCTGCACTGTAGTGG - Intronic
1109771948 13:66986289-66986311 TCTCATTATCCCCACTGTCATGG - Intronic
1112130912 13:96523074-96523096 TATCATTTGCTTGTCTGTAAAGG + Intronic
1114817864 14:25981098-25981120 CAGCATTTGCTCCTCTGTAAAGG - Intergenic
1115954258 14:38760288-38760310 TTTTATCTACTCCACTGTAAGGG + Intergenic
1117795422 14:59388613-59388635 TCTCCTTTTCTCCACAGAAAGGG + Intergenic
1118869706 14:69731208-69731230 TCTTATTTGCTCCATTTGAATGG + Intronic
1119151583 14:72365124-72365146 GCTCATTTGATCCACTACAAAGG - Intronic
1120488052 14:85139592-85139614 TTGCATTTGCTACAGTGTAAAGG - Intergenic
1120655695 14:87187384-87187406 TGTCATTTGCTGCACTCTTATGG - Intergenic
1121212157 14:92215358-92215380 TCCCATTTGCTCCTCTGCCAAGG - Intergenic
1123963917 15:25437830-25437852 TTTCATTTTCTACACTGAAAAGG + Intronic
1124895742 15:33775738-33775760 TCCCATCTGCTACTCTGTAATGG + Intronic
1127181837 15:56428698-56428720 TCTTTTTTGGTCTACTGTAAGGG - Intronic
1127375590 15:58381779-58381801 TCTCATTTCCTCAACTGTAATGG + Intronic
1127655781 15:61054420-61054442 TCTGATTTCCTCCTCTCTAAGGG - Intronic
1128744894 15:70106778-70106800 TCTCATTTGCTCCTGTGAAATGG + Intergenic
1129915528 15:79266732-79266754 TTTCATTTCCTCAACTGGAAGGG + Intergenic
1130866533 15:87937999-87938021 TCTCATTCCCTCCTCTGCAAAGG + Intronic
1135097023 16:19573012-19573034 TCTCTTTTATTCCACAGTAAAGG + Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136749277 16:32618302-32618324 AATCATTTGCTCCAACGTAATGG + Intergenic
1146402199 17:32508699-32508721 TCTCATTTCCTCTTCTGAAAAGG - Intronic
1148257993 17:46153715-46153737 TCTCATTTCTTCAAATGTAATGG - Intronic
1149376435 17:56048661-56048683 TCTCATTTCCATCCCTGTAAAGG + Intergenic
1153425784 18:4961433-4961455 TCTCATTGTCACCACTGCAATGG - Intergenic
1153721645 18:7909698-7909720 TCTCATTTGCTCCACTGTAAAGG + Intronic
1154145676 18:11864417-11864439 AATAATTTGTTCCACTGTAAAGG - Intronic
1156750297 18:40445264-40445286 TCTCATTTGGTTTTCTGTAATGG - Intergenic
1159179567 18:64884973-64884995 TCACTTTTGCACCAATGTAATGG + Intergenic
1160314649 18:77830659-77830681 GCTCATTTTCTCCACTCTAGGGG + Intergenic
1160328015 18:77968321-77968343 CCTCATTTCCTCCACTGTCCAGG - Intergenic
1161405293 19:4088134-4088156 CCTCATTTTCTCCACTGTGGAGG - Intergenic
1167814819 19:51870439-51870461 TCAGATTTGCTCTACAGTAAAGG - Intronic
1168649935 19:58086416-58086438 TCTTCTTTGCTCCACTGTCCAGG - Intronic
926330854 2:11824099-11824121 GCCAATTTCCTCCACTGTAAAGG - Intronic
926822884 2:16872540-16872562 CCTCATTTGCTCCTCTTTTAAGG - Intergenic
927192811 2:20528443-20528465 TCTGAGTTGTTCCACTCTAAAGG + Intergenic
932500753 2:72180724-72180746 TCTAATCTGCTCCTCTGCAAAGG - Intronic
933037666 2:77420756-77420778 TCCCATTTTGTCCACTGAAAGGG - Intronic
933037674 2:77420845-77420867 TCCCATTTTGTCCACTGAAAGGG - Intronic
936265675 2:111004349-111004371 TCTCACTTGCTCCCGGGTAAGGG - Intronic
937163680 2:119792371-119792393 CCTCACTTGCTTCACTGAAATGG - Intronic
937586964 2:123564497-123564519 TTACATTTGATCCACTGTAAAGG - Intergenic
941812834 2:169771048-169771070 TTTCATTTCATCCATTGTAATGG - Intronic
945415187 2:209562336-209562358 ACTCATATGCTCCAGTGAAAGGG - Intronic
946086651 2:217180238-217180260 TCTCATTTGCACCATTGATATGG + Intergenic
946669818 2:222090656-222090678 TTTCATTAGCTGCAGTGTAATGG + Intergenic
947664310 2:231893950-231893972 TCTCCTTTGCTCTACGGTGAAGG + Intergenic
1169070341 20:2723933-2723955 TCTCATTTTCTCTTCTTTAATGG + Intronic
1172363977 20:34334856-34334878 TCTCTTTTGTTCCTCTGTAAGGG + Intergenic
1176880046 21:14181037-14181059 TCTAGTTTCCTCAACTGTAAAGG + Intronic
1178263758 21:31123855-31123877 TCTCTATTGCTCCACTGTAATGG + Intronic
1179182190 21:39054868-39054890 TGTCATTTTCCCCACTGGAAGGG + Intergenic
1181186393 22:21108689-21108711 TCACATTTTAGCCACTGTAATGG + Intergenic
1182757867 22:32695307-32695329 GCTAATTTTCTCCTCTGTAATGG + Intronic
1183984795 22:41563451-41563473 TCCCATCTGCTCCCCTGTGATGG + Intronic
1184962023 22:47936866-47936888 TTTGTTTTGCTCCACTGTGATGG - Intergenic
950408901 3:12821585-12821607 CCTGATTTCCTCCATTGTAACGG + Intronic
950452832 3:13074850-13074872 GTTCATTTCCTCCCCTGTAAAGG - Intergenic
951347023 3:21559372-21559394 TCTCTTTTGCTTGTCTGTAAAGG + Intronic
951682034 3:25304999-25305021 TCTCAGTTTCTGAACTGTAATGG - Intronic
951777064 3:26322280-26322302 TCGCATTTGCTTGTCTGTAAAGG + Intergenic
954274915 3:49535866-49535888 CCTCAGTTCCTCCTCTGTAAGGG + Intergenic
955021373 3:55124932-55124954 TCTGCTTTCCTCCTCTGTAAAGG - Intergenic
955201795 3:56858271-56858293 TCTTCTTTCCTTCACTGTAATGG + Intronic
956758222 3:72411579-72411601 TCTCATTTGGTGCAATATAAAGG - Intronic
956819002 3:72935856-72935878 TCTAATGTACTCCACTGAAATGG + Intronic
959327783 3:104958625-104958647 TTTCATCTGCTCTACTGTAAAGG - Intergenic
959377916 3:105607575-105607597 ACTCATTTTCCCCAGTGTAATGG - Intergenic
962149856 3:132881351-132881373 TCTCATTTGGTTCACAGTGATGG - Intergenic
965115675 3:164484558-164484580 TCCCATTTTCTCCACTGTGATGG - Intergenic
965776258 3:172234523-172234545 TCTCATTTGATACCCTGTTAAGG - Intronic
966533100 3:181002714-181002736 CAGCATTTGCTCCTCTGTAAAGG + Intergenic
968985499 4:3872365-3872387 CCTCATTTCCTCCTCTCTAATGG + Intergenic
969970827 4:11046463-11046485 CCACATTTGCTTCTCTGTAAAGG + Intergenic
970523636 4:16910293-16910315 TCTGATTTTCTCCACTGTAGAGG + Intergenic
971922103 4:32954074-32954096 TCTCACCTGCTCCACTGGCAAGG - Intergenic
972862140 4:43182684-43182706 TATCATTTGGACCATTGTAATGG - Intergenic
975093931 4:70435914-70435936 TCACATTTGCTTGTCTGTAAAGG + Intronic
977848656 4:101797676-101797698 TGTCATTTACTCCATTGGAAAGG + Intronic
979487678 4:121286715-121286737 CATCATTTGCTTCTCTGTAAAGG - Intergenic
980066119 4:128190642-128190664 TCTCACCTGCTGCAGTGTAAGGG + Intronic
981428015 4:144626265-144626287 TCTCCAGTGCTCCACTGAAATGG - Intergenic
983320594 4:166191624-166191646 TCTCATCAGTTCCCCTGTAATGG - Intergenic
985167804 4:187116084-187116106 TCTAATTTGATTCACTGTAGAGG + Intergenic
986205488 5:5621189-5621211 TCTCATTTGCTGCAGCTTAAGGG + Intergenic
986586207 5:9320734-9320756 TCACATTTGTTCCTCTGAAAAGG - Intronic
987729179 5:21745789-21745811 TATTATTTGTTACACTGTAATGG - Intergenic
987739111 5:21882745-21882767 TCCCTTTGGCTCCATTGTAACGG - Intronic
988910320 5:35834209-35834231 TCTGATTTGTTCCACTGAAGTGG + Intergenic
990267423 5:54092529-54092551 TCTCCTTTGTTCCACTGAAATGG - Intronic
990901302 5:60752582-60752604 TCTAATTTATTCCACTGGAAAGG - Exonic
991086427 5:62652055-62652077 TCTCTTTTGGTTCACTGCAAAGG - Intergenic
991264202 5:64697895-64697917 TCTCATTTCCTTCTCTGTAGAGG + Intronic
992189692 5:74279546-74279568 ACTCAGTTTCTTCACTGTAATGG + Intergenic
994913008 5:105937450-105937472 TCTGATTGCCTCCACTGGAAAGG + Intergenic
995147041 5:108797909-108797931 TTTCGTTTGTTTCACTGTAATGG + Intronic
995909075 5:117163989-117164011 TCTTATTTGCCCAACTGTATAGG - Intergenic
998820562 5:146053993-146054015 TCTGATTTGCTCCACCGTGCAGG - Intronic
999373517 5:151070610-151070632 CCTCATTTCCTCTGCTGTAAAGG + Intronic
1001759707 5:174197284-174197306 TCTCAGCTCCTCCACTGTTATGG + Intronic
1001997127 5:176171342-176171364 GATCAATTGCTCCAGTGTAAGGG - Intergenic
1003032463 6:2614069-2614091 TCACATTTGCTCTCCTGTCAGGG + Intergenic
1007389843 6:41544850-41544872 TCTCAGTTGCCACACTGGAAAGG + Intergenic
1008125472 6:47663611-47663633 TCTCCTTTTCTGCAGTGTAAGGG + Intronic
1008608882 6:53167548-53167570 TCTCAGTTGCTCCATTCTCAAGG - Intergenic
1009290289 6:61871784-61871806 CCTCATTTGCTTTTCTGTAAAGG - Intronic
1010802612 6:80194687-80194709 TCTCATATGATGCACTGAAATGG - Intronic
1011229968 6:85149805-85149827 TCACATTTGCTTGTCTGTAAAGG + Intergenic
1012294709 6:97506880-97506902 TCTTATTTGCTCCAAAGTAATGG + Intergenic
1012354148 6:98292092-98292114 TCTCTTCTGGTCAACTGTAACGG + Intergenic
1013156623 6:107497289-107497311 TCTCATGTGCTCCACTTTCTTGG + Intronic
1013552568 6:111222778-111222800 TCTGACTTGCTCCAGTGTCAAGG + Exonic
1013815334 6:114091189-114091211 TCTCATTAGCCCCACTGAACTGG + Intronic
1014145395 6:117992375-117992397 TCACATCTGCTCCAATGTATAGG - Intronic
1014175168 6:118324344-118324366 TTTCATTTGCTTAACTGAAAAGG - Intergenic
1016774984 6:147895596-147895618 TCTCATTTGCTCGGCTTTCAAGG - Intergenic
1016789527 6:148053487-148053509 TCTCATTTGCTCAACTGTTTAGG + Intergenic
1018409008 6:163522117-163522139 TCTTATTTTCTCATCTGTAAAGG - Intronic
1020704725 7:11530212-11530234 GCTATTTTGCTCCACTGTACTGG + Intronic
1022242641 7:28527893-28527915 CCTACTTTGCACCACTGTAATGG + Intronic
1022981545 7:35609439-35609461 TCACACTTGCACCACTGCAATGG + Intergenic
1026200066 7:68206887-68206909 TCTCATTTGCTGGACTGTGAGGG + Intergenic
1027308889 7:76933115-76933137 TCTGCTTTTCTCCACTGGAATGG + Intergenic
1028197244 7:87921071-87921093 TCACACTTGCTCCCCAGTAATGG + Intergenic
1028292165 7:89078724-89078746 TATTATTTTCTCCTCTGTAAGGG + Intronic
1031527238 7:122836208-122836230 TATCATTTGCTTGTCTGTAAAGG - Intronic
1033189162 7:139261026-139261048 CCCCATTTTCTTCACTGTAATGG + Intronic
1034520397 7:151614859-151614881 GCTCTTTTGTTCCAGTGTAAAGG - Intronic
1038643664 8:29347199-29347221 CCACATTTGCTCCACTGCACTGG + Intronic
1041438477 8:57867696-57867718 TTTCATCTGCTTCACTGTAGAGG - Intergenic
1042626975 8:70769141-70769163 TAGCATTTGCTTGACTGTAAAGG + Intronic
1044079678 8:87868092-87868114 TCCCATTTGCTACACTCGAAAGG - Intergenic
1044405455 8:91820661-91820683 CATCATTTGCTTCCCTGTAAAGG - Intergenic
1045049472 8:98309695-98309717 TCTTGTTTGCACCATTGTAAAGG - Intergenic
1046399296 8:113683173-113683195 TCTAATTTCCTCCACAGTTATGG - Intergenic
1046844080 8:118896085-118896107 TCTTATTTGCTCCTATGTAGAGG + Intergenic
1047923675 8:129661115-129661137 TCTCAGTTGCTCCCCAGTGATGG + Intergenic
1048032573 8:130646469-130646491 CCTCATTTCCTCCTCTGTAAAGG + Intergenic
1049249945 8:141582935-141582957 TCTCAGTTCCCCCATTGTAACGG + Intergenic
1050234175 9:3561074-3561096 TAGCATTTGCTCGTCTGTAAAGG + Intergenic
1051534144 9:18138120-18138142 ACTCGTTTCCTCCTCTGTAAGGG + Intergenic
1051752349 9:20356363-20356385 TTTAACATGCTCCACTGTAAAGG + Intronic
1054911839 9:70462177-70462199 TCTCACCTGCACCACTGAAATGG - Intergenic
1055135284 9:72822224-72822246 TCTCATTTCCTTCACTGAAAAGG - Intronic
1056002827 9:82235292-82235314 TCTAATTTCCTGCAGTGTAAAGG + Intergenic
1057533277 9:95874189-95874211 TATTATTAGCTTCACTGTAATGG + Intergenic
1058078567 9:100676215-100676237 GTTCATTTGTTCCTCTGTAATGG - Intergenic
1058200801 9:102037427-102037449 TATCATATTCTCCACTGTCAGGG + Intergenic
1058614496 9:106811095-106811117 TAGCATTTGCTGCTCTGTAAAGG - Intergenic
1058943757 9:109837307-109837329 CATCATTTGCTTCTCTGTAAAGG - Intronic
1059773030 9:117445650-117445672 TCTCAGATGCTCCACTCTAAAGG - Intergenic
1189583848 X:42436613-42436635 TATCATTTGCTTCTCTGAAATGG - Intergenic
1191133101 X:57036242-57036264 TCTCATTTGCTCATTTCTAAAGG + Intergenic
1192692301 X:73376602-73376624 TAGCATTTGCTTCACTGGAAAGG - Intergenic
1194478415 X:94389386-94389408 TCTGATTTTCTTCACTGCAAAGG + Intergenic
1198072356 X:133161262-133161284 TCTCATGTGCTTGTCTGTAAAGG - Intergenic
1199058938 X:143330284-143330306 TCTTATTACCTCCACTTTAAGGG - Intergenic