ID: 1153722606

View in Genome Browser
Species Human (GRCh38)
Location 18:7922248-7922270
Sequence GTTAAGCAGCACCTCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 11, 3: 36, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153722606_1153722609 4 Left 1153722606 18:7922248-7922270 CCTACAGTGAGGTGCTGCTTAAC 0: 1
1: 0
2: 11
3: 36
4: 137
Right 1153722609 18:7922275-7922297 ACTCTGATTTGGCATCCCTTTGG 0: 1
1: 2
2: 1
3: 15
4: 117
1153722606_1153722607 -7 Left 1153722606 18:7922248-7922270 CCTACAGTGAGGTGCTGCTTAAC 0: 1
1: 0
2: 11
3: 36
4: 137
Right 1153722607 18:7922264-7922286 GCTTAACAGCCACTCTGATTTGG 0: 1
1: 28
2: 76
3: 66
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153722606 Original CRISPR GTTAAGCAGCACCTCACTGT AGG (reversed) Intronic
901860681 1:12072551-12072573 GTTAAACAGCACATCAGTGCTGG + Intronic
902569357 1:17336952-17336974 ATTAAGCAGCCCCACCCTGTAGG - Intronic
903280417 1:22247038-22247060 ATGAAGGAGCCCCTCACTGTGGG + Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
907781568 1:57571828-57571850 GTTACGGAGCAAGTCACTGTGGG + Intronic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915966951 1:160317332-160317354 GGTAAGCAGAACCTCACTCCGGG - Intronic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
916793515 1:168145369-168145391 CTTAATCCGCATCTCACTGTGGG - Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918479002 1:184957028-184957050 GTTTACCAGCACATCACTGCTGG - Intronic
921146254 1:212360571-212360593 GTCAAACAGCACCTCTCTTTGGG + Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922419746 1:225451586-225451608 GTAAAGAAGCATCTCCCTGTGGG + Intergenic
1065823717 10:29550821-29550843 GTTCAGCAGCACCTCCGGGTCGG + Exonic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1069854679 10:71433503-71433525 GGTAAGCACCACCTCCCTGCTGG + Intronic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074330750 10:112506323-112506345 ATTAAGCAACACATGACTGTAGG + Intronic
1076643961 10:131938660-131938682 CGTAAGCAGCACCTCACTCTGGG + Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1078616596 11:12871674-12871696 GGGAAGCACCACCACACTGTGGG + Intronic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080923985 11:36737185-36737207 GTTAAGCAGCAGTACCCTGTAGG - Intergenic
1082195310 11:49297973-49297995 GCTATGCAGTACCTCACTGTGGG - Intergenic
1086660621 11:89411579-89411601 GCTACGCAGTACCTCACTGTGGG + Intronic
1088160340 11:106862533-106862555 AAGAAGCAGCACCTCACTGAAGG + Intronic
1089931768 11:122320033-122320055 GTAAAGCAGCACTGCACTCTGGG - Intergenic
1089990649 11:122856701-122856723 GCTTAGGAGAACCTCACTGTGGG + Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094433612 12:30397552-30397574 GTGAGGCAGCACTCCACTGTGGG - Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1098459889 12:70720956-70720978 GTTAAGGAGCACCTCTATATAGG - Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1113712460 13:112477265-112477287 GTAAAGCATGACTTCACTGTTGG - Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116387293 14:44347498-44347520 TTTAAGCAGCACCCCACTCCTGG - Intergenic
1116817533 14:49598228-49598250 GTTAAGCAGGCGCTCACGGTCGG - Intronic
1117520699 14:56548703-56548725 GTCAAGCAGGAAATCACTGTTGG + Intronic
1118136579 14:63034574-63034596 ATTAAGCAGACCATCACTGTAGG + Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1127863710 15:63014745-63014767 GATAAGCAGCCCCTCTCTGAAGG + Intergenic
1130484544 15:84391402-84391424 GTTCAGCAGCCCCTCTCTGCAGG + Intergenic
1136291975 16:29279441-29279463 GTGAGGCTGCATCTCACTGTGGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1142097865 16:88253396-88253418 GTGAGGCTGCATCTCACTGTGGG + Intergenic
1144233343 17:13231272-13231294 GTTCAGCACCAGCTCTCTGTGGG + Intergenic
1145740488 17:27270186-27270208 GAGAATCAGCACGTCACTGTTGG - Intergenic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1150493298 17:65589064-65589086 TTTATGCCCCACCTCACTGTGGG + Intronic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1154195492 18:12263073-12263095 GAAAAGCAGCATCTCACTGGGGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155243042 18:23881721-23881743 GTTAAGCACCGCGTCACTGAGGG + Intronic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157988861 18:52471561-52471583 TTTCAGCAGCACCTAACTCTGGG + Intronic
1161173153 19:2823485-2823507 ATTGAGCAGCTCCTCCCTGTTGG + Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1164369248 19:27627968-27627990 GATATTCAGCACTTCACTGTAGG - Intergenic
1167252102 19:48404873-48404895 GTCAGTCAGCACCTCAATGTAGG - Exonic
925629796 2:5879954-5879976 TTAAAGAAGCACATCACTGTGGG - Intergenic
925942248 2:8831735-8831757 GAAAAGCAGCCCCTGACTGTCGG + Intronic
926767831 2:16337920-16337942 GTTAAGCAACACATGACTGTAGG + Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
935052483 2:99535662-99535684 GGTAGGCCTCACCTCACTGTGGG - Intergenic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941865801 2:170333067-170333089 CTTAAGCAGCTCTTCTCTGTGGG + Intronic
944590404 2:201211921-201211943 GTGAAGTAGCATCTCACTGTGGG + Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
945823490 2:214692704-214692726 GTGAAGTAGCATCTCATTGTGGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1168970771 20:1929406-1929428 GTTAAGGACCACCTCAAGGTTGG + Intronic
1169508581 20:6240009-6240031 GGTGAGCAGCACATCCCTGTGGG - Intergenic
1169555283 20:6743085-6743107 GTTTAGCAGCTCCTAACTCTTGG - Intergenic
1170042455 20:12052855-12052877 GTTGAGCAGCATTTAACTGTTGG + Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1173234606 20:41233239-41233261 GTTAAGCAACACCTAAATGGGGG + Intronic
1174391536 20:50221007-50221029 ATTAAGCAGCACCACCCTGGTGG - Intergenic
1174940873 20:54925452-54925474 GTTATGCTCCACCTCACTGAGGG + Intergenic
1179876005 21:44267843-44267865 GAGAACCAGGACCTCACTGTGGG - Intergenic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
1184655381 22:45939045-45939067 GTGAAGTGGCATCTCACTGTGGG - Intronic
949673419 3:6425447-6425469 TTTCAGCAGCACCTCACTCCTGG + Intergenic
950296521 3:11837214-11837236 CAGAAGCAGCACATCACTGTTGG + Intronic
951318881 3:21220993-21221015 TTAAAGCAGCACAACACTGTAGG - Intergenic
951491862 3:23279778-23279800 GTTAAGCAGAAGCTCATTCTAGG - Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
952977665 3:38709801-38709823 GTTAAGCAGGGCATCATTGTGGG + Intronic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
965279758 3:166734776-166734798 GTTAAGCAGCATCACAAGGTAGG + Intergenic
966684398 3:182678327-182678349 GTTCAGCTGCAGCTGACTGTAGG - Intergenic
966805189 3:183802102-183802124 GTGACGCAGCACGTCACTTTGGG - Intronic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
975791086 4:77951829-77951851 GATAAGCAGCATCTCATTGCAGG - Intronic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980173416 4:129316352-129316374 GTGTAGTAGCACCTCATTGTGGG + Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984505340 4:180610553-180610575 GTTAGTCATCAGCTCACTGTAGG - Intergenic
984865434 4:184276570-184276592 GTATAGCAGCACCCCACTCTTGG - Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
994225679 5:97249568-97249590 GTTGGCCAGCACCTCACAGTAGG + Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
997518773 5:134508822-134508844 CTTTAGCAGCACCTCAATTTGGG + Intergenic
997821478 5:137070003-137070025 TTGCAGCAGCACCTCCCTGTAGG + Intronic
997881626 5:137597153-137597175 GTTCAGCAGCTGCTCACTCTTGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000301511 5:159960769-159960791 GATAAGCAGCACCTGAGTGCTGG - Intronic
1000793443 5:165634793-165634815 GGAAACCAGCACCTCTCTGTGGG - Intergenic
1001011575 5:168103840-168103862 CTTAAGAAGCAGCTGACTGTTGG + Intronic
1001099408 5:168801795-168801817 GTGAATCATCATCTCACTGTGGG + Intronic
1001414073 5:171531057-171531079 ATTAAGCAGCTCCTCTCTGCTGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1004817368 6:19326693-19326715 GTCAACCATCAGCTCACTGTGGG - Intergenic
1004960914 6:20786979-20787001 GTTAAGCAGCATCTAACTCTTGG - Intronic
1007182761 6:39942333-39942355 GTTAAACAGCAACTCACTGTAGG - Intergenic
1007367012 6:41401609-41401631 GTTTACCAGCACACCACTGTTGG + Intergenic
1007982813 6:46176420-46176442 ATTAAGCAGCAGATCACTGTAGG + Intergenic
1012601594 6:101104914-101104936 GTTAAGTAGATTCTCACTGTAGG - Intergenic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1013918045 6:115365964-115365986 TTTCAGCAGCACCTCACTCCTGG - Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019285365 7:220561-220583 GTTAAGCATGACCTCTGTGTAGG + Intronic
1020425310 7:8059265-8059287 GATGAGCAGCAACTCACAGTTGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1030070391 7:105693073-105693095 ATCAAGCAGTATCTCACTGTAGG + Intronic
1030810000 7:113960106-113960128 TTTTAGCAGCACCTCACTCCTGG + Intronic
1034875075 7:154718579-154718601 TTTAAAGAGGACCTCACTGTGGG - Intronic
1037896832 8:22662366-22662388 GTGAAACAGCATCTCATTGTTGG + Intronic
1039592518 8:38761535-38761557 TTTAATGAGCACATCACTGTGGG + Intronic
1040768620 8:50946035-50946057 GTTCCTCAGCACCTCACCGTCGG + Intergenic
1046506858 8:115147545-115147567 TTTCAGCAGCACCTCACTTCTGG + Intergenic
1048140497 8:131789653-131789675 TTTAGGCAGCAGCTCACTCTTGG + Intergenic
1051320598 9:15900646-15900668 TAAAAGCAGCACCTCACTCTAGG - Intronic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1057202963 9:93152862-93152884 GCTAACCAGCACGCCACTGTTGG + Intergenic
1059004210 9:110383815-110383837 GCTAAGCAGGACCTCCCTGCGGG - Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1062573532 9:137196210-137196232 GTCTAGCAGGACCTGACTGTGGG - Intronic
1187794406 X:22986417-22986439 GTAAAGCAGTATCTCATTGTGGG + Intergenic
1188152597 X:26696931-26696953 AATAAGAAGCAGCTCACTGTTGG - Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1201011975 Y:9556636-9556658 ATTAAGGCGCACCTCACTATTGG - Intergenic