ID: 1153722606

View in Genome Browser
Species Human (GRCh38)
Location 18:7922248-7922270
Sequence GTTAAGCAGCACCTCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153722606_1153722607 -7 Left 1153722606 18:7922248-7922270 CCTACAGTGAGGTGCTGCTTAAC No data
Right 1153722607 18:7922264-7922286 GCTTAACAGCCACTCTGATTTGG No data
1153722606_1153722609 4 Left 1153722606 18:7922248-7922270 CCTACAGTGAGGTGCTGCTTAAC No data
Right 1153722609 18:7922275-7922297 ACTCTGATTTGGCATCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153722606 Original CRISPR GTTAAGCAGCACCTCACTGT AGG (reversed) Intronic