ID: 1153722607

View in Genome Browser
Species Human (GRCh38)
Location 18:7922264-7922286
Sequence GCTTAACAGCCACTCTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153722606_1153722607 -7 Left 1153722606 18:7922248-7922270 CCTACAGTGAGGTGCTGCTTAAC No data
Right 1153722607 18:7922264-7922286 GCTTAACAGCCACTCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153722607 Original CRISPR GCTTAACAGCCACTCTGATT TGG Intronic