ID: 1153722794

View in Genome Browser
Species Human (GRCh38)
Location 18:7923732-7923754
Sequence TGCCATTAACTCCCCTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153722794_1153722797 -8 Left 1153722794 18:7923732-7923754 CCCTTACAGGGGAGTTAATGGCA 0: 1
1: 0
2: 1
3: 15
4: 392
Right 1153722797 18:7923747-7923769 TAATGGCAACTATTTTTTCTGGG 0: 1
1: 0
2: 2
3: 29
4: 362
1153722794_1153722796 -9 Left 1153722794 18:7923732-7923754 CCCTTACAGGGGAGTTAATGGCA 0: 1
1: 0
2: 1
3: 15
4: 392
Right 1153722796 18:7923746-7923768 TTAATGGCAACTATTTTTTCTGG 0: 1
1: 0
2: 1
3: 27
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153722794 Original CRISPR TGCCATTAACTCCCCTGTAA GGG (reversed) Intronic
900996434 1:6125705-6125727 TGCCATCAGCTCCCCTGACATGG + Intronic
903566940 1:24274741-24274763 AACCATTCACTCCCCTGGAAAGG - Intergenic
904835585 1:33333570-33333592 TCTCATTAACTCCCCTTTCAAGG + Intronic
906557832 1:46728496-46728518 AACCATTTACTCCCCTGGAAGGG + Intergenic
906753260 1:48285419-48285441 AACCATTCACTCCCCTGGAAAGG - Intergenic
907015156 1:51005372-51005394 AACCATTTACTCCCCTGGAAAGG + Intergenic
907409305 1:54273551-54273573 TGCCAACACCTCCCCTGCAAAGG - Intronic
907600096 1:55760529-55760551 AACCATTCACTCCCCTGGAAAGG + Intergenic
908404743 1:63803739-63803761 TGCCATGAACAATCCTGTAAAGG - Intronic
908644593 1:66263829-66263851 GGCCATTCATTCCCCTGTCAAGG - Intronic
909332075 1:74425608-74425630 TACCAATAACTCCCCTGGCATGG + Intronic
909415651 1:75402845-75402867 AACCATTTACTCCCCTGGAAAGG + Intronic
911193664 1:94972460-94972482 TGCCCTTAAGTCTCCTGTAAAGG + Intergenic
912076753 1:105884679-105884701 AACCATTCACTCCCCTGGAAAGG - Intergenic
912301422 1:108520730-108520752 TTCCATTCACTGCCCTGGAAAGG - Intergenic
912966219 1:114239727-114239749 AACCATTCACTCCCCTGGAAAGG + Intergenic
913391279 1:118315223-118315245 TGCTTTTCACTCCCCGGTAAAGG + Intergenic
915876499 1:159616524-159616546 AACCATTCACTCCCCTGGAAAGG + Intergenic
916140521 1:161693297-161693319 AACCATTCACTCCCCTGGAAAGG + Intergenic
916612822 1:166409892-166409914 AACCATTCACTCCCCTGGAAAGG - Intergenic
916916075 1:169408068-169408090 AACCATTCACTCCCCTGGAAAGG + Intronic
917091709 1:171359685-171359707 AGCCATTCACTCCCCTGGAAAGG + Intergenic
918167268 1:181961916-181961938 AACCATTCACTCCCCTGGAAAGG - Intergenic
919461694 1:197884509-197884531 AACCATTCACTCCCCTGGAAAGG - Intergenic
921308077 1:213816995-213817017 TTCTATTTACTCCCCTATAAGGG - Intergenic
921401412 1:214727638-214727660 AACCATTCACTCCCCTGGAAGGG - Intergenic
921626158 1:217379816-217379838 AACCATTTACTCCCCTGGAAAGG + Intergenic
921631320 1:217437382-217437404 AACCATTAACTCCTCTGGAAAGG + Intronic
921962211 1:221047585-221047607 AACCATTCACTCCCCTGAAAAGG + Intergenic
922406243 1:225316342-225316364 AACCATTCACTCCCCTGGAAAGG - Intronic
923066996 1:230527261-230527283 AACCATTCACTCCCCTGGAAAGG - Intergenic
923690938 1:236192315-236192337 AACCATTCACTCCCCTGGAAAGG - Intronic
1064455741 10:15485881-15485903 TGACATTTACTCCCCTCAAAAGG + Intergenic
1065427395 10:25619660-25619682 AACCATTCACTCCCCTGGAAAGG + Intergenic
1066993521 10:42539695-42539717 AACCATTCACTCCCCTGGAAAGG - Intergenic
1067332297 10:45333615-45333637 AACCATTCACTCCCCTGGAAAGG - Intergenic
1067579590 10:47433810-47433832 AACCATTCACTCCCCTGGAAAGG - Intergenic
1068086126 10:52375218-52375240 AACCATTCACTCCCCTGGAATGG - Intergenic
1071002046 10:80841740-80841762 AACCATTCACTCCCCTGGAAAGG - Intergenic
1072365385 10:94703725-94703747 AACCATTCACTCCCCTGGAAAGG - Intronic
1072404380 10:95136332-95136354 AACCATTCACTCCCCTGGAAAGG + Intergenic
1073698105 10:105893581-105893603 AACCATTCACTCCCCTGGAAAGG + Intergenic
1074795537 10:116939156-116939178 AACCATTCACTCCCCTGGAAAGG - Intronic
1075983943 10:126767036-126767058 AACCATTCACTCCCCTGAAAAGG - Intergenic
1076389771 10:130090563-130090585 AACCATTCACTCCCCTGGAAAGG + Intergenic
1077425265 11:2473118-2473140 TGGGATTAACTCCCCTGTGCTGG + Intronic
1077562077 11:3270411-3270433 AACCATTCACTCCCCTGGAAAGG - Intergenic
1077567971 11:3316231-3316253 AACCATTCACTCCCCTGGAAAGG - Intergenic
1079316502 11:19412073-19412095 AACCATTCACTCCCCTGGAAAGG + Intronic
1079696096 11:23484171-23484193 AACCATTCACTCCCCTGGAAAGG + Intergenic
1079714876 11:23732047-23732069 AACCATTCACTCCCCTGGAAAGG + Intergenic
1080117701 11:28639109-28639131 AACCATTCACTCCCCTGGAAAGG + Intergenic
1080265094 11:30392187-30392209 AGCGATTGACTCCCCTCTAATGG + Intronic
1082670678 11:56033275-56033297 AACCATTCACTCCCCTGGAAAGG + Intergenic
1083033247 11:59613895-59613917 TTCCATCAACTCCACTGTATTGG - Intronic
1083169001 11:60911155-60911177 AGCCATAAACTCCCCAGTAGAGG - Intergenic
1083510195 11:63202300-63202322 AACCATTCACTCCCCTGTAAAGG + Intronic
1083516248 11:63261808-63261830 AGCCATTCACTCCCCTGGAAAGG - Intronic
1084522471 11:69672770-69672792 GTCCATTAACTCCCATGCAAAGG + Intronic
1085433832 11:76481395-76481417 AACCATTCACTCCCCTGGAAAGG + Intronic
1086608422 11:88725047-88725069 AACCATTCACTCCCCTGGAAAGG + Intronic
1087667764 11:101070474-101070496 AACCATTCACTCCCCTGGAAGGG + Intronic
1087695324 11:101369797-101369819 AACCATTCACTCCCCTGGAAAGG - Intergenic
1087703818 11:101466696-101466718 AACCATTCACTCCCCTGGAAAGG - Intronic
1087712167 11:101567022-101567044 AACCATTCACTCCCCTGGAAAGG + Intronic
1088702521 11:112426207-112426229 AACCATTCACTCCCCTGGAAAGG + Intergenic
1088918248 11:114243102-114243124 AGCCATCCACTCCCCTGTTAGGG - Intronic
1090307461 11:125703591-125703613 AACCATTTACTCCCCTGGAAAGG + Intergenic
1090688842 11:129156241-129156263 AACCATTTACTCCCCTGGAAAGG + Intronic
1090720383 11:129467198-129467220 AACCATTCACTCCCCTGGAAAGG + Intergenic
1090896139 11:130977079-130977101 AACCATTCACTCCCCTGGAAAGG - Intergenic
1091090058 11:132762804-132762826 AACCATTAACTCCCCTGGAAAGG - Intronic
1091213550 11:133885231-133885253 AACCATTCACTCCCCTGGAAAGG - Intergenic
1092638864 12:10481822-10481844 AACCATTCACTCCCCTGGAAAGG + Intergenic
1092838534 12:12515745-12515767 TGCCATTACCTACCCATTAATGG + Intronic
1093336072 12:17906043-17906065 AACCATTCACTCCCCTGGAAAGG - Intergenic
1094031889 12:26021678-26021700 TGCCATTACCTTGCTTGTAAGGG + Intronic
1095488461 12:42708342-42708364 AACCATTCACTCCCCTGGAAAGG + Intergenic
1095694837 12:45132682-45132704 AACCATTCACTCCCCTGCAAAGG + Intergenic
1095831497 12:46591651-46591673 AACCATTCACTCCCCTGGAAAGG - Intergenic
1097908822 12:64947739-64947761 TGGCAGGAACTCCCCTGAAATGG + Intergenic
1098052903 12:66472976-66472998 AACCATTCACTCCCCTGGAAAGG + Intronic
1098635600 12:72780350-72780372 AACCATTCACTCCCCTGGAAAGG + Intergenic
1099238955 12:80116040-80116062 AACCATTCACTCCCCTGGAAAGG - Intergenic
1099435292 12:82635154-82635176 AACCATTCACTCCCCTGGAAAGG - Intergenic
1099486273 12:83232801-83232823 AACCATTCACTCCCCTGGAAAGG - Intergenic
1099798038 12:87422647-87422669 AACCATTCACTCCCCTGGAAAGG - Intergenic
1100740021 12:97581542-97581564 AACCATTCACTCCCCTGGAAAGG + Intergenic
1100768764 12:97898297-97898319 AACCATTCACTCCCCTGGAAAGG - Intergenic
1101315418 12:103624507-103624529 TCCCATTAAATCCTCTCTAAAGG - Intronic
1102642226 12:114377130-114377152 TGGCATTAACTCCCCTCTTAGGG - Intronic
1103916399 12:124378058-124378080 TGCCAGAAACTCACCAGTAATGG - Intronic
1104169689 12:126268157-126268179 TGCAATTAAGTCACCAGTAAAGG - Intergenic
1104685290 12:130780851-130780873 TGCCATCACCTCCCGTGGAATGG + Intergenic
1105769381 13:23594253-23594275 AACCATTCACTCCCCTGGAAAGG + Intronic
1106336613 13:28789176-28789198 AACCATTCACTCCCCTGGAAAGG - Intergenic
1106377468 13:29203502-29203524 AACCATTCACTCCCCTGGAAAGG - Intronic
1106426616 13:29636649-29636671 AACCATTCACTCCCCTGGAAAGG - Intergenic
1107289855 13:38839946-38839968 AACCATTCACTCCCCTGGAAAGG - Intronic
1107674108 13:42776941-42776963 AACCATTTACTCCCCTGGAAAGG - Intergenic
1108048828 13:46409083-46409105 AACCATTCACTCCCCTGGAAAGG - Intronic
1108674070 13:52721290-52721312 AACCATTCACTCCCCTGGAAAGG - Intronic
1108806938 13:54170040-54170062 GTCCATTAACTCCTGTGTAAGGG - Intergenic
1109541358 13:63782428-63782450 AACCATTCACTCCCCTGGAAAGG - Intergenic
1109828703 13:67757300-67757322 TGCCATTGACTCCCCATTAGAGG + Intergenic
1110135493 13:72062572-72062594 AACCATTCACTCCCCTGGAAAGG + Intergenic
1111062314 13:83038247-83038269 TGCCATTATTTCCACTGAAATGG - Intergenic
1111417792 13:87972090-87972112 TGCCATTAGCTCACATGCAAGGG + Intergenic
1112678664 13:101735695-101735717 TGTTATTAACTCCCCAGGAAGGG + Intronic
1114341915 14:21754226-21754248 AACCATTCACTCCCCTGGAAAGG + Intergenic
1114433766 14:22686168-22686190 AGCCATTCACTCCCCTGGAAAGG + Intergenic
1114710039 14:24768603-24768625 AACCATTCACTCCCCTGGAAAGG + Intergenic
1114744956 14:25136871-25136893 AACCATTCACTCCCCTGGAAAGG + Intergenic
1115008212 14:28511760-28511782 AACCATTCACTCCCCTGGAAAGG - Intergenic
1115538022 14:34391668-34391690 AACCATTCACTCCCCTGGAAAGG + Intronic
1117237948 14:53798363-53798385 AACCATTCACTCCCCTGGAAAGG + Intergenic
1117617107 14:57545049-57545071 AACCATTCACTCCCCTGGAAAGG - Intergenic
1117930569 14:60837212-60837234 AACCATTCACTCCCCTGGAAAGG - Intronic
1117932214 14:60855303-60855325 AACCATTCACTCCCCTGGAAAGG - Intronic
1118516123 14:66530437-66530459 AGCCATTCACTCCCCCGGAAAGG - Intronic
1120773873 14:88411360-88411382 AACCATTCACTCCCCTGGAAAGG - Intronic
1121026564 14:90620635-90620657 TGCCAAGAACTCCCCTCCAATGG + Intronic
1122671987 14:103379571-103379593 TGCCATTCACTCACCTGGAAAGG - Intergenic
1122801030 14:104229552-104229574 GGCCATCATCTCCCCTGTGAGGG - Intergenic
1125219525 15:37317522-37317544 AACCATTCACTCCCCTGGAAAGG + Intergenic
1125259338 15:37804562-37804584 TGCCAGTTACTCCCAGGTAAGGG - Intergenic
1125330027 15:38573558-38573580 AACCATTCACTCCCCTGGAAAGG - Intergenic
1127158019 15:56149859-56149881 AACCATTTACTCCCCTGGAAAGG + Intronic
1129507987 15:76099071-76099093 AACCATTCACTCCCCTGGAAAGG - Intronic
1130702912 15:86203727-86203749 TGCCATTACCTCCATTGTTACGG + Intronic
1138706481 16:58920632-58920654 AACCATTCACTCCCCTGGAAAGG - Intergenic
1138843682 16:60539264-60539286 AACCATTTACTCCCCTGGAAAGG - Intergenic
1138886885 16:61090919-61090941 AACCATTCACTCCCCTGGAAAGG + Intergenic
1139669944 16:68485765-68485787 TGCCATTCTCTCCCCAGCAAAGG + Intergenic
1140882257 16:79209554-79209576 TGCCATTAACTCCCGAGTGGTGG - Intronic
1141337862 16:83174132-83174154 AGCCCTCAACTCCCCTGAAATGG - Intronic
1143342436 17:6223786-6223808 TGCCATTAAATTCCCTCTCAGGG - Intergenic
1148967355 17:51447122-51447144 AACCATTCACTCCCCTGGAAAGG + Intergenic
1150090734 17:62322759-62322781 AACCATTCACTCCCCTGGAAAGG + Intergenic
1151064214 17:71131984-71132006 AACCATTCACTCCCCTGGAAAGG - Intergenic
1151284416 17:73099676-73099698 TGCCATTTCCTCCCCTGTGCTGG + Intergenic
1153722794 18:7923732-7923754 TGCCATTAACTCCCCTGTAAGGG - Intronic
1154191698 18:12235726-12235748 GGGCATAAACTCCCCTGTGAAGG - Intergenic
1154382258 18:13863228-13863250 AACCATTCACTCCCCTGGAAAGG - Intergenic
1155857369 18:30850263-30850285 AACCATTCACTCCCCTGGAAAGG - Intergenic
1156415158 18:36880020-36880042 AACCATTCACTCCCCTGGAAAGG - Intronic
1156768266 18:40686435-40686457 TGCCATTCTCTCCTCTGGAATGG + Intergenic
1157451812 18:47794791-47794813 TTTCATTACCTCCCCTTTAAAGG + Intergenic
1159385996 18:67726025-67726047 AACCATTCACTCCCCTGGAAAGG - Intergenic
1161150885 19:2708368-2708390 TGCCGTTAACATTCCTGTAAGGG + Intergenic
1165126725 19:33603320-33603342 TACCATATAATCCCCTGTAATGG - Intergenic
1165970430 19:39624267-39624289 AACCATTCACTCCCCTGTAAAGG - Intergenic
1166263165 19:41657186-41657208 TACCATTTACTCCCCTGGAAAGG + Intronic
1168530886 19:57127768-57127790 AACCATTCACTCCCCTGGAAAGG - Intronic
927117126 2:19916388-19916410 AACCATTCACTCCCCTGGAAAGG + Intronic
928213322 2:29340129-29340151 TGCCATTAATCTCCCTGCAAAGG + Intronic
928576741 2:32663166-32663188 AACCATTCACTCCCCTGGAAAGG - Intronic
929143848 2:38689239-38689261 AGCCTTTGACTCCCCTGCAAAGG + Intronic
930359298 2:50358230-50358252 AACCATTCACTCCCCTGGAAAGG + Intronic
930439894 2:51391824-51391846 AACCATTCACTCCCCTGGAAAGG + Intergenic
930476681 2:51891376-51891398 TACCGTTCACTCCCCTGGAAAGG - Intergenic
931212116 2:60207321-60207343 AACCATTCACTCCCCTGGAAAGG - Intergenic
931814806 2:65890117-65890139 AGTCATTCACTCCCCTGGAAAGG + Intergenic
932511831 2:72300512-72300534 AACCATTCACTCCCCTGGAAAGG - Intronic
932814079 2:74847856-74847878 AGCCATTCAGTCCCCAGTAAGGG - Intronic
933413232 2:81951195-81951217 AACCATTCACTCCCCTGGAAAGG - Intergenic
934871786 2:97872892-97872914 AACCATTCACTCCCCTGGAAAGG + Intronic
939021451 2:136962578-136962600 TGTCATGCCCTCCCCTGTAAGGG + Intronic
940594034 2:155767061-155767083 AACCATTTACTCCCCTGGAAAGG - Intergenic
940821376 2:158359824-158359846 AACCATTCACTCCCCTGGAAAGG + Intronic
940925147 2:159356138-159356160 AACCATTCACTCCCCTGGAAAGG + Intronic
941845264 2:170126053-170126075 AACCATTCACTCCCCTGGAAAGG + Intergenic
942010891 2:171761525-171761547 AACCATTCACTCCCCTGGAAAGG - Intergenic
943105676 2:183543694-183543716 AACCATTCACTCCCCTGGAAGGG + Intergenic
944258859 2:197654438-197654460 TGTCTTTAACACCCCTCTAATGG - Intronic
945013013 2:205485052-205485074 TGCCATTACCTCGCCTGAATGGG + Intronic
945409143 2:209488436-209488458 AACCATTCACTCCCCTGGAAAGG + Intronic
945486928 2:210407182-210407204 AACCATTCACTCCCCTGGAAAGG - Intergenic
1169320076 20:4625313-4625335 AACCATTCACTCCCCTGGAAAGG - Intergenic
1169984131 20:11423114-11423136 AACCATTCACTCCCCTGGAAAGG - Intergenic
1170133882 20:13052541-13052563 AACCATTCACTCCCCTGGAAAGG + Intronic
1170294209 20:14806590-14806612 AACCATTCACTCCCCTGGAAAGG + Intronic
1170727367 20:18941846-18941868 AACCATTCACTCCCCTGGAAAGG - Intergenic
1171000825 20:21413984-21414006 AACCATTTACTCCCCTGGAAAGG + Intergenic
1173318668 20:41968163-41968185 AACCATTCACTCCCCTGGAAAGG - Intergenic
1175040929 20:56050016-56050038 AACCATTTACTCCCCTGGAAAGG + Intergenic
1177540967 21:22493646-22493668 AACCATTCACTCCCCTGGAAAGG + Intergenic
1178007080 21:28234192-28234214 AGCCATTCACTCCCTTGGAAAGG + Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1183021518 22:35030935-35030957 GACCATTCACTCCCCTGGAAAGG - Intergenic
949463786 3:4322819-4322841 TCCCAGTAACTCCCCTGGCATGG + Intronic
949762418 3:7485809-7485831 TGCCATTAACTTCCATGCAGTGG - Intronic
949908977 3:8884730-8884752 TGCCAGGAACTCCCCTGCTAAGG - Intronic
951795514 3:26533991-26534013 TGCCATTCACTCCCCTGGAAAGG - Intergenic
954510520 3:51120956-51120978 AACCATTCACTCCCCTGGAAAGG - Intronic
954718167 3:52537338-52537360 TGCCAATGACTGTCCTGTAAAGG - Intronic
954978715 3:54723383-54723405 AACCATTCACTCCCCTGGAAAGG - Intronic
955414323 3:58678586-58678608 AACCATTCACTCCCCTGGAAAGG - Intergenic
955657859 3:61263799-61263821 AACCATTCACTCCCCTGGAAAGG - Intergenic
957219655 3:77365360-77365382 TGTCAGTAACTCCCCTCTGAGGG - Intronic
957474819 3:80709580-80709602 AACCATTCACTCCCCTGGAAAGG + Intergenic
957776466 3:84761160-84761182 AACCATTCACTCCCCTGCAAAGG + Intergenic
958694595 3:97511167-97511189 AACCATTCACTCCCCTGGAAAGG - Intronic
959842840 3:110998772-110998794 AACCATTCACTCCCCTGGAAAGG + Intergenic
961310563 3:125996729-125996751 AACCATTCACTCCCCTGGAAAGG + Intergenic
962512317 3:136114435-136114457 AACCATTCACTCCCCTGGAAGGG + Intronic
964232455 3:154486930-154486952 AACCATTCACTCCCCTGGAAAGG + Intergenic
964371391 3:156004077-156004099 AACCATTCACTCCCCTGGAAAGG - Intergenic
965025477 3:163296917-163296939 AACCATTCACTCCCCTGAAAAGG + Intergenic
966561480 3:181325229-181325251 AACCATTCACTCCCCTGGAAAGG - Intergenic
969164839 4:5298779-5298801 AACCATTCACTCCCCTGGAAAGG - Intronic
970214553 4:13745365-13745387 AGCCATTCACTCCTCTGGAAAGG - Intergenic
971673631 4:29595666-29595688 AACCATTGACTCCCCTGGAAAGG - Intergenic
971697853 4:29929778-29929800 AGCCATTCACTCCCCTGAAAAGG + Intergenic
972372486 4:38438203-38438225 AACCATTCACTCCCCTGGAAAGG - Intergenic
973660874 4:53105336-53105358 AGCCGTTCACTCCCCTGGAAAGG + Intronic
974560060 4:63506095-63506117 AACCATTCACTCCCCTGGAAAGG + Intergenic
975367329 4:73544604-73544626 AACCATTCACTCCCCTGGAAAGG + Intergenic
976023965 4:80664719-80664741 AACCATTCACTCCCCTGGAAAGG - Intronic
976439257 4:85054948-85054970 AACCATTCACTCCCCTGGAAAGG + Intergenic
977425511 4:96863019-96863041 AGCCCTTCACTCCCCTGGAAAGG + Intergenic
977500244 4:97828543-97828565 AACCATTCACTCCCCTGGAAAGG + Intronic
977774399 4:100900595-100900617 AACCATTCACTCCCCTGGAAAGG + Intergenic
977792912 4:101128897-101128919 AACCATTCACTCCCCTGGAAAGG + Intronic
977994428 4:103484906-103484928 AACCATTTACTCCCCTGGAAAGG + Intergenic
978186088 4:105858400-105858422 AACCATTCACTCCCCTGGAAAGG - Intronic
978278357 4:106978730-106978752 AACCATTCACTCCCCTGCAAAGG - Intronic
979119782 4:116883345-116883367 AACCATTCACTCCCCTGGAAAGG - Intergenic
979421367 4:120509258-120509280 AACCATTCACTCCCCTGGAAAGG + Intergenic
980243437 4:130205422-130205444 TGCAATTAAATCCCATCTAAAGG + Intergenic
981134009 4:141189888-141189910 AACCATTCACTCCCCTGAAACGG - Intronic
981273147 4:142867870-142867892 AACCATTCACTCCCCTGGAAAGG + Intergenic
981629668 4:146804384-146804406 AACCATTCACTCCCCTGGAAAGG + Intronic
981739042 4:147983821-147983843 TCCCACTAACTCCCCAGCAATGG - Intronic
981859877 4:149341525-149341547 AACCATTTACTCCCCTGGAAAGG - Intergenic
982825709 4:160001803-160001825 AACCATTCACTCCCCTGGAAAGG + Intergenic
983840832 4:172455358-172455380 AACCATTCACTCCCCTGGAAAGG + Intronic
983958832 4:173727938-173727960 AACCATTCACTCCCCTGGAAAGG - Intergenic
986006044 5:3669903-3669925 AACCATTCACTCCCCTGGAAAGG - Intergenic
986378857 5:7162794-7162816 AACCATTCACTCCCCTGGAAAGG - Intergenic
986484315 5:8220162-8220184 AGCCATTCACTCCCTTGGAAAGG + Intergenic
986879562 5:12153651-12153673 AACCATTCACTCCCCTGGAAAGG + Intergenic
987019232 5:13852519-13852541 AACCATTCACTCCCCTGGAAAGG + Intronic
987924108 5:24317959-24317981 AACCATTCACTCCCCTGGAAAGG - Intergenic
988402078 5:30775584-30775606 AACCATTCACTCCCCTGGAAAGG + Intergenic
988772610 5:34447791-34447813 AACCATTCACTCCCCTGGAAAGG - Intergenic
988867729 5:35354032-35354054 AGCCATTCACTCCCCTAGAAAGG - Intergenic
990803482 5:59631893-59631915 AGCCATTCAATCCCCTGGAAGGG + Intronic
991368059 5:65889271-65889293 TCCCATTCACTTTCCTGTAATGG - Intergenic
991611735 5:68456492-68456514 TGCCATTAACCCCCATCTGAGGG - Intergenic
992153227 5:73926962-73926984 TGTAATTAACTCCTCTTTAATGG - Intronic
992254907 5:74911757-74911779 AACCATTCACTCCCCTGGAAAGG - Intergenic
992740647 5:79770293-79770315 AACCATTCACTCCCCTGGAAAGG - Intronic
993138612 5:84001781-84001803 AGCCATTAAGTCCCCTTTGATGG - Intronic
993757651 5:91751203-91751225 AACCATCAACTCCCCTGGAAAGG - Intergenic
993891668 5:93482601-93482623 AACCATTCACTCCCTTGTAAAGG + Intergenic
995093936 5:108213283-108213305 AACCATTCACTCCCCTGGAAAGG - Intronic
995111831 5:108437412-108437434 AACCATTCACTCCCCTGGAAAGG + Intergenic
996910911 5:128655963-128655985 AACCATTCACTCCCCTGGAAAGG - Intronic
997216617 5:132116910-132116932 AACCATTCACTCCCCTGGAAAGG + Intergenic
997251755 5:132393932-132393954 TGCCATTTACAACCCTTTAATGG - Intronic
997809559 5:136954034-136954056 AACCATTCACTCCCCTGGAAAGG - Intergenic
998691650 5:144594731-144594753 AACCATTTACTCCCCTGGAAAGG - Intergenic
999468641 5:151831299-151831321 AACCATTCACTCCCCTGGAAAGG + Intronic
999502409 5:152160298-152160320 AACCATTCACTCCCCTGGAAAGG - Intergenic
999556782 5:152752102-152752124 AACCATTCACTCCCCTGGAAAGG + Intergenic
1000406457 5:160893197-160893219 AACCATTCACTCCCCTGAAAAGG + Intergenic
1002677139 5:180926472-180926494 AACCATTCACTCCCCTGGAAAGG + Intronic
1002996088 6:2286675-2286697 AACCATTCACTCCCCTGGAAAGG + Intergenic
1003376895 6:5588045-5588067 GGCCTTTAACTCCCCAGTGAAGG + Intronic
1004880055 6:19998521-19998543 TGCCACTAACTGCCCTTTCATGG + Intergenic
1005778385 6:29162020-29162042 AACCATTTACTCCCCTGGAAAGG - Intergenic
1006199933 6:32279366-32279388 AACCATTCACTCCCCTGGAAAGG + Intergenic
1006788038 6:36680722-36680744 TGCCATTACCACCCCTTCAAAGG + Intronic
1008407625 6:51136430-51136452 AACCATTCACTCCCCTGAAAAGG - Intergenic
1008521301 6:52363719-52363741 TGCCCTTGACTGCCCTGTTAAGG + Intronic
1008896867 6:56566186-56566208 AACCATTCACTCCCCTGGAAAGG - Intronic
1009276672 6:61690415-61690437 TGCCATTAACTCAGCAGAAAAGG + Intronic
1009458735 6:63887807-63887829 AACCATTCACTCCCCTGGAAAGG + Intronic
1009709650 6:67300624-67300646 AACCATTCACTCCCCTGGAAAGG - Intergenic
1009727892 6:67558332-67558354 AACCATTCACTCCCCTGGAAAGG - Intergenic
1009797818 6:68494905-68494927 AACCATTCACTCCCCTGGAAAGG + Intergenic
1010459443 6:76097696-76097718 AACCATTTACTCCCCTGGAAAGG + Intergenic
1010868050 6:81004947-81004969 TGTCATTATATCCCCTGTGATGG + Intergenic
1011120057 6:83942613-83942635 AACCATTCACTCCCCTGGAAAGG + Intronic
1011387709 6:86815622-86815644 AACCATTCACTCCCCTGGAAAGG - Intergenic
1011703504 6:89978286-89978308 TGCAATTTCCTGCCCTGTAATGG - Intronic
1011831268 6:91374700-91374722 AACCATTCACTCCCCTGGAAAGG - Intergenic
1012083100 6:94785430-94785452 AACCATTCACTCCCCTGGAAAGG - Intergenic
1012777964 6:103522021-103522043 AACCATTCACTCCCCTGGAAAGG + Intergenic
1012870864 6:104671229-104671251 AGCCATTCACTCCCCTGGAAAGG + Intergenic
1013956888 6:115852451-115852473 AACCATTCACTCCCCTGGAAAGG + Intergenic
1013964183 6:115935498-115935520 AACCATTCACTCCCCTGGAAGGG + Exonic
1014177055 6:118342534-118342556 AACCATTCACTCCCCTGAAAAGG - Intergenic
1014223571 6:118823097-118823119 AACCATTCACTCCCCTGGAAAGG - Intronic
1014527849 6:122522372-122522394 AACCATTCACTCCCCTGGAAAGG - Intronic
1014836579 6:126167105-126167127 AACCATTCACTCCCCTGGAAAGG - Intergenic
1014922405 6:127228638-127228660 AACCATTCACTCCCCTGGAAAGG + Intergenic
1015291047 6:131538712-131538734 GACCATTCACTCCCCTGGAAAGG + Intergenic
1015802048 6:137070283-137070305 AACCATTTACTCCCCTGGAAAGG + Intergenic
1016483518 6:144508228-144508250 AACCATTCACTCCCCTGGAAAGG - Intronic
1017968733 6:159290525-159290547 AACCATTCACTCCCCTGGAAAGG - Intergenic
1020823873 7:13002953-13002975 AACCATTCACTCCCCTGGAAAGG - Intergenic
1021167040 7:17354434-17354456 AACCATTCACTCCCCTGGAAAGG - Intergenic
1021483916 7:21146687-21146709 GACCATTCACTCCCCTGGAAAGG + Intergenic
1022848488 7:34235626-34235648 AACCATTCACTCCCCTGGAAAGG - Intergenic
1023697795 7:42865420-42865442 AACCATTCACTCCCCTGGAAAGG - Intergenic
1024017691 7:45332982-45333004 AGCCGTTCACTCCCCTGGAAAGG + Intergenic
1024495418 7:50040807-50040829 AACCATTCACTCCCCTGGAAAGG + Intronic
1027446099 7:78274935-78274957 AACCATTCACTCCCCTGGAAAGG - Intronic
1028145906 7:87319506-87319528 AACCATTCACTCCCCTGGAAAGG - Intergenic
1029845283 7:103406169-103406191 AGCCATTCACTCCCTTGGAAAGG - Intronic
1030159514 7:106493022-106493044 AACCATTCACTCCCCTGGAAAGG + Intergenic
1030325872 7:108217909-108217931 AACCATTCACTCCCCTGGAAAGG - Intronic
1030705659 7:112690154-112690176 AACCATTCACTCCCCTGGAAAGG - Intergenic
1030771133 7:113475900-113475922 AACCATTCACTCCCCTGGAAAGG - Intergenic
1030801312 7:113856419-113856441 AACCGTTCACTCCCCTGTAAAGG + Intergenic
1030973152 7:116087050-116087072 TGCCATGAAATTCCTTGTAATGG - Intronic
1031031811 7:116743377-116743399 AACCATTCACTCCCCTGGAAAGG + Intronic
1031613798 7:123857174-123857196 AACCATTCACTCCCCTGGAAAGG - Intronic
1031974404 7:128084767-128084789 TGCCAGTCACCCCCCTGTAGAGG + Exonic
1035192307 7:157182125-157182147 TGCCAGAAACTCCTCTGTGAAGG - Exonic
1035794037 8:2337062-2337084 AACCATTCACTCCCCTGGAAAGG + Intergenic
1035798768 8:2384646-2384668 AACCATTCACTCCCCTGGAAAGG - Intergenic
1037470466 8:19203825-19203847 TGGCACTAGCTCCCCAGTAATGG + Intergenic
1037664501 8:20956439-20956461 AACCATTCACTCCCCTGGAAAGG + Intergenic
1037719622 8:21431504-21431526 AACCATTCACTCCCCTGGAAAGG + Intergenic
1040736530 8:50515452-50515474 AACCATTCACTCCCCTGGAAAGG + Intronic
1040968836 8:53112474-53112496 AACCATTTACTCCCCTGGAAAGG - Intergenic
1041135301 8:54751685-54751707 TGCCATTAGCTATCATGTAACGG + Intergenic
1041666292 8:60448217-60448239 AACCATTCACTCCTCTGTAAAGG + Intergenic
1041900658 8:62978706-62978728 AACCATTCACTCCCCTGGAAAGG - Exonic
1042349316 8:67761267-67761289 TACCATTCACTTCCCTGGAAAGG + Intergenic
1042478788 8:69280348-69280370 AACCATTCACTCCCCTGGAAAGG + Intergenic
1042946159 8:74156654-74156676 AACCATTCACTCCCCTGGAAAGG + Intergenic
1043532403 8:81165803-81165825 AACCATTCACTCCCCTGGAAAGG + Intergenic
1044960990 8:97530309-97530331 AACCATTCACTCCCCTGGAAAGG + Intergenic
1045199642 8:99967381-99967403 AACCATTCACTCCCCTGGAAAGG + Intronic
1045390553 8:101710414-101710436 AGCCATTCACTCCCCTGGAAAGG + Intronic
1045783653 8:105897123-105897145 AACCATTCACTCCCCTGGAAAGG + Intergenic
1046153506 8:110257869-110257891 AACCATTCACTCCCCTGGAAAGG - Intergenic
1046952828 8:120034372-120034394 TGACATTATCTAACCTGTAAGGG - Intronic
1046972569 8:120238598-120238620 AACCATTCACTCCCCTGGAAAGG - Intronic
1047842503 8:128767874-128767896 TTACATTAGCTCCCCAGTAATGG + Intergenic
1048274382 8:133055153-133055175 TGCCTTTGTCTCCCCTGTTAAGG - Intronic
1048914152 8:139165664-139165686 AACCATTTACTCCCCTGGAAAGG - Intergenic
1050234421 9:3562872-3562894 ACCCATTCACTCCCCTGGAAAGG - Intergenic
1050450811 9:5779647-5779669 AACCATTCACTCCCCTGGAAAGG + Intronic
1051814293 9:21087373-21087395 AACCATTCACTCTCCTGTAAAGG + Intergenic
1052329353 9:27251646-27251668 AACCATTCACTCCCCTGGAAAGG + Intergenic
1052336422 9:27324603-27324625 AACCATTCACTCCCCTGGAAAGG - Intergenic
1052506334 9:29359091-29359113 AACCATTCACTCCCCTGGAAAGG + Intergenic
1055386855 9:75771867-75771889 AACCATTTACTCCCCTGGAAAGG - Intergenic
1056003556 9:82242992-82243014 AACCATTCACTCCCCTGAAAAGG - Intergenic
1056200172 9:84267933-84267955 TATCATTAAGTCCCCTGTATTGG - Intergenic
1056320884 9:85433542-85433564 AACCATTCACTCCCCTGGAAAGG + Intergenic
1058072905 9:100619601-100619623 AGCCGTTCACTCCCCTGGAAAGG - Intergenic
1058173878 9:101715305-101715327 TGCCAGTATTTCCCATGTAATGG - Intronic
1058958212 9:109968794-109968816 TGCCACTAAGACCCCTGGAAAGG + Intronic
1062082717 9:134632897-134632919 TGGCACTAACTTCCCTGTGAGGG - Intergenic
1186599831 X:11024786-11024808 AACCATTCACTCCCCTGGAAAGG - Intergenic
1187839964 X:23476889-23476911 AGCCATTTACTGCCCTGGAAAGG - Intergenic
1188561269 X:31471141-31471163 AACCATTCACTCCCCTGGAAAGG - Intronic
1189039789 X:37530448-37530470 AACCATTCACTCCCCTGGAAAGG - Intronic
1189189609 X:39088955-39088977 AACCATTCACTCCCCTGAAAAGG + Intergenic
1190966443 X:55305709-55305731 AACCATTCACTCCCCTGGAAAGG - Intergenic
1190995713 X:55606483-55606505 AACCATTCACTCCCCTGGAAAGG - Intergenic
1191094375 X:56659142-56659164 GACCATTCACTCCCCTGGAAAGG - Intergenic
1191119721 X:56890772-56890794 AACCATTCACTCCCCTGGAAAGG + Intergenic
1191127814 X:56975936-56975958 TCCCATTTACTACCCTATAAAGG - Intergenic
1191133316 X:57038024-57038046 AACCATTCACTCCCCTGGAAAGG - Intergenic
1191186655 X:57620641-57620663 AACCATTCACTCCCCTGGAAAGG + Intergenic
1191222323 X:58002895-58002917 AACCATTCACTCCCCTGGAAAGG + Intergenic
1191872961 X:65765370-65765392 AACCATTCACTCCCCTGGAAAGG - Intergenic
1191908978 X:66127211-66127233 AACCATTCACTCCCCTGGAAAGG - Intergenic
1191947727 X:66553945-66553967 AACCATTCACTCCCCTGGAAAGG + Intergenic
1192064301 X:67864727-67864749 AACCATTCACTCCCCTGGAAAGG - Intergenic
1192759218 X:74078042-74078064 ACCCATTCACTCCCCTGGAAAGG - Intergenic
1192884297 X:75320542-75320564 AACCATTCACTCCCCTGGAAAGG - Intergenic
1192933985 X:75839251-75839273 AACCATTCACTCCCCTGGAAAGG - Intergenic
1192971278 X:76233795-76233817 AACCATTCACTCCCCTGGAAAGG + Intergenic
1193040487 X:76998969-76998991 AACCATTCACTCCCCTGGAAAGG - Intergenic
1193113793 X:77756337-77756359 ACCCATTCACTCCCCTGGAAAGG - Intronic
1193161395 X:78233052-78233074 AACCATTCACTCCCCTGGAAAGG - Intergenic
1193774183 X:85622591-85622613 AACCATTCACTCCCCTGAAAAGG + Intergenic
1194315313 X:92369503-92369525 AACCATTCACTCCCCTGGAAAGG - Intronic
1194545121 X:95225117-95225139 AACCATTCACTCCCCTGAAAGGG + Intergenic
1194771773 X:97915409-97915431 AACCATTTACTCCCCTGGAAAGG + Intergenic
1194961073 X:100236454-100236476 AACCATTCACTCCCCTGGAAAGG - Intergenic
1195730305 X:107959919-107959941 AACCATTCACTCCCCTGGAAAGG - Intergenic
1195881809 X:109600734-109600756 TTCCACTGACTCCCCTTTAAGGG - Intergenic
1196273189 X:113735990-113736012 AACCATTCACTCCCCTGGAAAGG - Intergenic
1196312356 X:114183633-114183655 AACCATTCACTCCCCTGGAAAGG + Intergenic
1196946620 X:120833052-120833074 AACCATTCACTCCCCTGGAAAGG - Intergenic
1197051161 X:122061183-122061205 AACCATTCACTCCCCTGGAAAGG + Intergenic
1197184718 X:123573644-123573666 AACCATTCACTCCCCTGGAAAGG + Intergenic
1197350156 X:125372740-125372762 AACCATTCACTCCCCTGGAAAGG - Intergenic
1197466829 X:126815085-126815107 TGCCATTAGCTCCTCAGTAATGG + Intergenic
1198207908 X:134485853-134485875 TCCCATTGAATCTCCTGTAAGGG + Intronic
1198518966 X:137433527-137433549 AACCATTTACTCCCCTGGAAAGG + Intergenic
1199100654 X:143795898-143795920 TTCCATTAAATGCCATGTAATGG - Intergenic
1199477389 X:148260395-148260417 AACCATTCACTCCCCTGGAAAGG - Intergenic
1199688211 X:150283204-150283226 TGCTATTACCACCCCTGCAAAGG - Intergenic
1200333199 X:155319710-155319732 AACCATTCACTCCCCTGGAAAGG + Intronic
1200365432 X:155657602-155657624 AACCATTCACTCCCCTGGAAAGG - Intronic
1200623361 Y:5481038-5481060 AACCATTCACTCCCCTGGAAAGG - Intronic
1200664102 Y:5999104-5999126 AACCATTTACTCCCCTGGAAAGG + Intergenic
1201490844 Y:14539941-14539963 AACCATTCACTCCCCTGGAAAGG + Intronic
1201946355 Y:19514949-19514971 AGCCATTCACTCCCCTGGAAAGG + Intergenic