ID: 1153728592

View in Genome Browser
Species Human (GRCh38)
Location 18:7983063-7983085
Sequence GTGTTTGACAAGCAGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153728592_1153728594 0 Left 1153728592 18:7983063-7983085 CCTCTTTTCTGCTTGTCAAACAC 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1153728594 18:7983086-7983108 ATGTACTTTCATATAAAGTAGGG 0: 1
1: 0
2: 3
3: 19
4: 268
1153728592_1153728593 -1 Left 1153728592 18:7983063-7983085 CCTCTTTTCTGCTTGTCAAACAC 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1153728593 18:7983085-7983107 CATGTACTTTCATATAAAGTAGG 0: 1
1: 0
2: 0
3: 21
4: 238
1153728592_1153728595 1 Left 1153728592 18:7983063-7983085 CCTCTTTTCTGCTTGTCAAACAC 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1153728595 18:7983087-7983109 TGTACTTTCATATAAAGTAGGGG 0: 1
1: 0
2: 0
3: 14
4: 254
1153728592_1153728599 28 Left 1153728592 18:7983063-7983085 CCTCTTTTCTGCTTGTCAAACAC 0: 1
1: 0
2: 3
3: 38
4: 295
Right 1153728599 18:7983114-7983136 CAACCCCCTGACTGCCAACCAGG 0: 1
1: 0
2: 0
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153728592 Original CRISPR GTGTTTGACAAGCAGAAAAG AGG (reversed) Intronic
900308613 1:2022936-2022958 GTGTAAAACAAGAAGAAAAGTGG + Intronic
901500214 1:9648109-9648131 TTATTTAACAGGCAGAAAAGGGG + Intergenic
901613469 1:10518163-10518185 GTTTTTGACAAGAAGCAAAGAGG - Intronic
901934157 1:12616568-12616590 GTGTTTGGAAAGCAGGAAAGAGG - Intronic
904609779 1:31719205-31719227 GTGTTTGAGGAGCAGAGAGGAGG + Intergenic
907132833 1:52111744-52111766 GCACTTGACAATCAGAAAAGAGG - Intergenic
907972299 1:59394978-59395000 GCAGTTGACAAGCAGAAAAAAGG - Intronic
908416085 1:63914687-63914709 GAGTTTGCCAAGCAGAGAAGAGG - Intronic
908827578 1:68148469-68148491 GTGTTTGAAAAGGAGAATGGTGG - Intronic
908960599 1:69692717-69692739 GTGTATTACAAGCACACAAGAGG - Intronic
910354826 1:86342182-86342204 GTGTGTGGGGAGCAGAAAAGTGG - Intergenic
910813734 1:91265693-91265715 GAGTTTGACAACTAGAACAGAGG - Intronic
911113563 1:94218735-94218757 GTGTTTGAAATACAGAAAAAAGG + Intronic
911415783 1:97571533-97571555 GAGGTTGAAAAGGAGAAAAGTGG + Intronic
911745766 1:101440293-101440315 GTTTGTGACATGCAGAAAATGGG - Intergenic
912597083 1:110889921-110889943 GAGTAAGACAAGAAGAAAAGAGG + Intronic
912807766 1:112771433-112771455 GTGTTTCACTACCAGGAAAGAGG - Intergenic
913121350 1:115743833-115743855 GTGTTTGAAAATCAGAGGAGCGG + Intronic
913262320 1:117010724-117010746 GAGTTTGTTAAGCTGAAAAGGGG - Intronic
915102439 1:153510005-153510027 GTGTTTGCCAAGCACCAAAGTGG - Intergenic
915809884 1:158896967-158896989 ATGTTTAAGAAGCAAAAAAGGGG - Intergenic
916530316 1:165650340-165650362 CTGTTTTCCAAGTAGAAAAGAGG + Intronic
917255159 1:173108024-173108046 TTGTTAGGCAAGCAGCAAAGAGG + Intergenic
918113096 1:181475485-181475507 GAGTGGGAGAAGCAGAAAAGAGG + Intronic
918820942 1:189253433-189253455 TTTTTTTACATGCAGAAAAGAGG + Intergenic
918909545 1:190548137-190548159 GTGAGTGCTAAGCAGAAAAGTGG - Intergenic
918955597 1:191203023-191203045 GTGTTTGAAAAGCAAGAAATGGG + Intergenic
919289986 1:195617327-195617349 GTTTCTTCCAAGCAGAAAAGGGG - Intergenic
919518706 1:198560039-198560061 GTGTATCACAAGCTAAAAAGAGG - Intergenic
920705442 1:208247473-208247495 TTCTTTGACAAGCAAAGAAGAGG - Intergenic
921727035 1:218535197-218535219 ATGCTTGCCAAGCAGAAAGGTGG - Intergenic
922248536 1:223824832-223824854 GTGTTTGATGAACAGCAAAGAGG - Intronic
922277241 1:224090365-224090387 GTGTTTGAAAAACAGCATAGAGG - Intergenic
922743594 1:228030677-228030699 GTGTTTGAGAAGCAGCCAAGAGG - Intronic
923392251 1:233524048-233524070 GTCTTTGACAAGACCAAAAGAGG - Intergenic
1063993004 10:11586689-11586711 GTGGTTAACAACAAGAAAAGGGG + Intronic
1064186442 10:13166178-13166200 GTCTTTGAGAAGCTGAGAAGTGG + Intronic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1065804103 10:29378994-29379016 GTTTGGGACAAGGAGAAAAGTGG - Intergenic
1067235133 10:44440431-44440453 GGATTTGACAAGCCAAAAAGGGG - Intergenic
1067257522 10:44658480-44658502 GTATTAGTCAAGGAGAAAAGGGG - Intergenic
1067533210 10:47089383-47089405 GTGTTTGAGAAGAAGAGAAATGG - Intergenic
1069238476 10:66108343-66108365 ATGTTTGAGGAGGAGAAAAGGGG - Intronic
1069569709 10:69486923-69486945 GGCTCTGATAAGCAGAAAAGAGG - Intronic
1072989229 10:100174970-100174992 GTGGTTGACAATCACCAAAGAGG + Intronic
1073173623 10:101535264-101535286 GTCTTAGAGAAGCAGAAAACAGG - Intronic
1073650444 10:105352844-105352866 GCGTTGGACATGCTGAAAAGAGG - Intergenic
1073664809 10:105519119-105519141 GTTTTTGACCTGCAGCAAAGGGG - Intergenic
1075114242 10:119612740-119612762 GTCTTTCACAAGGGGAAAAGGGG - Intergenic
1077747813 11:4927101-4927123 GTTTATGACAGACAGAAAAGAGG + Intronic
1077894803 11:6446177-6446199 GTGTTTGAGAATCTGAAAGGAGG - Intergenic
1078811986 11:14777291-14777313 GTGTTTGAGAAGGAGAAAGGGGG + Intronic
1080040862 11:27758084-27758106 GTGTTTTGCCAGCATAAAAGGGG + Intergenic
1080996627 11:37610150-37610172 GTTTTTGATAAGAAGAAAAGTGG + Intergenic
1082691829 11:56314389-56314411 ATGTTTGCCAAGCTGACAAGGGG + Intergenic
1083826889 11:65208990-65209012 GTGCTTCACTAGCAGAGAAGAGG - Intronic
1084320106 11:68368598-68368620 GTGTTTGAGAAGCTGAAGGGAGG + Intronic
1084578368 11:70005940-70005962 GTGTTTTACAGACTGAAAAGTGG - Intergenic
1084653413 11:70501965-70501987 ATGTTAGATAAACAGAAAAGAGG + Intronic
1085806103 11:79637833-79637855 GACTTTGAGAAGCTGAAAAGAGG + Intergenic
1086493167 11:87376001-87376023 GGGTTTGAAGAGAAGAAAAGGGG - Intergenic
1087597844 11:100276169-100276191 TTTTTTGGCATGCAGAAAAGGGG - Intronic
1088814746 11:113413283-113413305 TTGTTTGACAGGGAGAACAGGGG - Intronic
1090497383 11:127227367-127227389 GTGATTGTCAAGCAGACCAGAGG + Intergenic
1092291640 12:7162892-7162914 GCGTTTGACAGGCAGAGAGGAGG + Intergenic
1094437789 12:30440584-30440606 GAATTTGCCAAGCAGAAAATTGG - Intergenic
1095225625 12:39673578-39673600 ATGTTTGAGAAACAGAAGAGGGG - Intronic
1095438628 12:42219506-42219528 GTGTTTGCTAAACAGAAAGGGGG + Intronic
1095991793 12:48039813-48039835 GAGTTTTACAGGTAGAAAAGTGG + Intergenic
1096818915 12:54218718-54218740 GTGTCTGTCAAACAGACAAGAGG - Intergenic
1097833951 12:64254413-64254435 GTGTTTCAGAAAGAGAAAAGTGG + Intergenic
1098662593 12:73115493-73115515 GTATTTGACAAGATGAAAAATGG - Intergenic
1098823571 12:75264879-75264901 GTGTTTGAAAAGCAGTGAGGTGG - Intergenic
1098924758 12:76337186-76337208 GAGTGTGACAAGAAGCAAAGAGG + Intergenic
1103197389 12:119056601-119056623 GGGTTTGAAAAACTGAAAAGAGG - Intronic
1103215884 12:119201121-119201143 GTGTCTGAGGAGCAGAAAGGTGG - Intronic
1103489302 12:121304522-121304544 CTGTTTTACAGGCAGGAAAGCGG - Intergenic
1104189312 12:126463755-126463777 GTGCTTGAGGAGCAGAAAAGAGG + Intergenic
1104334750 12:127883567-127883589 GTGTTTGACAAGGTGAGAGGTGG + Intergenic
1104443789 12:128817411-128817433 TTTTTTGACAAGCATAAAAGAGG + Intronic
1106426831 13:29639132-29639154 ATGTTTGAAAAGAAGAAAGGTGG + Intergenic
1106552545 13:30784698-30784720 GTGTTTGAGAAGCAGAAAGGGGG + Intergenic
1106596712 13:31148148-31148170 GTGCTACACAAACAGAAAAGAGG + Intronic
1106691307 13:32120384-32120406 GTGTTAGTCAAGCAGAAAATGGG + Intronic
1106875224 13:34064771-34064793 GTGTTGGACAAGAAAAAAAAAGG + Intergenic
1107762629 13:43696902-43696924 GTCTTAAACAAGCAGAAATGAGG + Intronic
1107918496 13:45178221-45178243 GTGTAGCACAAGCAGAAAAGGGG - Intronic
1109966529 13:69705745-69705767 GTATTTTACAAACAGCAAAGTGG - Intronic
1110251244 13:73383109-73383131 TTATCTGACATGCAGAAAAGTGG - Intergenic
1112624581 13:101089492-101089514 GTGTCTGAAAAGCAGCAATGAGG + Intronic
1116067586 14:40003794-40003816 GTGTTCTAGAAGCACAAAAGAGG + Intergenic
1116190079 14:41653797-41653819 GGGCTGGAGAAGCAGAAAAGGGG + Intronic
1116775427 14:49175061-49175083 GTGTTTGAGAAACAGCAAACAGG + Intergenic
1117072900 14:52072076-52072098 GTTTTTTACAGGCAGAAAAGGGG - Intergenic
1117313363 14:54550373-54550395 GTGTTAGAGGAACAGAAAAGAGG + Intergenic
1117622583 14:57602715-57602737 GTGCTTGACAAGTATAACAGTGG - Intronic
1117942919 14:60988235-60988257 ATGGTTGAGAAGCAGAAATGTGG - Intronic
1118182861 14:63510647-63510669 GTGTTTGAGAAACAGCAAGGAGG + Intronic
1118638216 14:67767438-67767460 GAGTGTGACAAGCAGAAAGCTGG - Intronic
1120545918 14:85811243-85811265 GTGTGTGAGGAGCAGCAAAGAGG + Intergenic
1120909590 14:89653931-89653953 GAAATTGACAAGCAGATAAGGGG - Intergenic
1121267438 14:92613495-92613517 GTGTTTGATATGCAGAAAGAAGG + Intronic
1121576028 14:94988611-94988633 GTGATAGAAAAGCAGAAATGTGG + Intergenic
1121842110 14:97143259-97143281 GAGTTTGCCAAGCAGAGAAAGGG + Intergenic
1121868316 14:97383665-97383687 GTTTTTAACAAGCGGTAAAGTGG + Intergenic
1124401029 15:29347692-29347714 GTGATTGAAAAGAAGATAAGGGG + Intronic
1124721270 15:32112927-32112949 TAATTTGAGAAGCAGAAAAGTGG - Intronic
1125120888 15:36157390-36157412 GTGTGTAACAAGCAGAGAGGAGG - Intergenic
1125318640 15:38458789-38458811 GTCTTTGAGAAGCAGAGCAGAGG - Intronic
1125476190 15:40049658-40049680 TTGCTTGACAAGCAGAACATGGG + Intergenic
1125948446 15:43729937-43729959 GTGTTTGAGAAACAGCAAAGAGG - Intergenic
1127703648 15:61526375-61526397 ATGTTTGACAAATAGAACAGAGG + Intergenic
1128265183 15:66259888-66259910 GAGTTTGCCAAGCTTAAAAGAGG - Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129496047 15:75981825-75981847 ATGTTTTAAAATCAGAAAAGAGG + Intronic
1131376114 15:91924941-91924963 GTGTTTGATAGGCAGGAAATAGG + Intronic
1133361279 16:5175726-5175748 GTCTTTCAGAAGCTGAAAAGAGG + Intergenic
1133892424 16:9893222-9893244 ATGTTAAAGAAGCAGAAAAGAGG + Intronic
1134382618 16:13742123-13742145 GTGTTTGCCAAGGAGGAAAGAGG - Intergenic
1134384845 16:13762089-13762111 GAGGTTGAAAAGGAGAAAAGTGG - Intergenic
1135303255 16:21348722-21348744 GTGCATGACACACAGAAAAGAGG - Intergenic
1136299998 16:29327916-29327938 GTGCATGACACACAGAAAAGAGG - Intergenic
1137804132 16:51287593-51287615 TAGTTTGACAAAGAGAAAAGGGG - Intergenic
1137845018 16:51678466-51678488 GTGTTTGCCAAGCTGAGAAGGGG - Intergenic
1138044418 16:53706086-53706108 ATGTTTCACAAGCAGAAAATGGG - Intronic
1139234119 16:65316711-65316733 GTGTTTGTCAAGTGGAAAATTGG - Intergenic
1140524660 16:75612615-75612637 AGTTTTGGCAAGCAGAAAAGTGG - Exonic
1140563166 16:76008254-76008276 GTGTTTGAGAAACAGAAAGAAGG - Intergenic
1141546455 16:84773332-84773354 GTGTTTGGGAAGCAGAAAAGAGG + Intronic
1142061734 16:88034685-88034707 GTGCATGACACACAGAAAAGAGG - Intronic
1143939594 17:10526338-10526360 GTGCTTGACAAACAGCAATGAGG + Intronic
1144222619 17:13113706-13113728 GTGTTTGACAAGGTGCTAAGGGG + Intergenic
1144297077 17:13886292-13886314 GGGCTTGCCCAGCAGAAAAGAGG - Intergenic
1148926586 17:51091618-51091640 GTGTGAGAAAAACAGAAAAGGGG - Intronic
1149313422 17:55418000-55418022 GTGTTTAAGGAGCAGAAAGGAGG - Intronic
1149369877 17:55982816-55982838 GAGTCTGACAAGCACTAAAGTGG + Intergenic
1149524302 17:57342020-57342042 GTGTTTAACCAGAACAAAAGAGG + Intronic
1151038582 17:70830385-70830407 GTGTTTGACAAACAGATATGGGG - Intergenic
1152028006 17:77824249-77824271 GAGTTTGCCAAGCAGACAAAGGG + Intergenic
1152181114 17:78822422-78822444 GTCTGTGACCAGCAGAGAAGTGG - Intronic
1153728592 18:7983063-7983085 GTGTTTGACAAGCAGAAAAGAGG - Intronic
1155665347 18:28300960-28300982 GTGTTGGATAAGGAGAAAAGTGG + Intergenic
1159152871 18:64542729-64542751 GTGTTGGAAGAGAAGAAAAGAGG - Intergenic
1160063993 18:75557922-75557944 GTGTTAGACACACAGAAAGGGGG + Intergenic
1162079592 19:8210039-8210061 GTGTGTGCGGAGCAGAAAAGAGG + Intronic
1167819696 19:51916134-51916156 GTGTTTCCCAAGTACAAAAGGGG + Intronic
1167838429 19:52094676-52094698 GTGGGTGACAAGCAGAGTAGAGG - Intronic
1167846613 19:52170431-52170453 GTGGGTGACAAGCAGAGTAGAGG - Intronic
926078415 2:9962178-9962200 GTGTGTGAAAGACAGAAAAGGGG + Intronic
927001785 2:18803087-18803109 GAGTTTGCCAAGCAGAGAAGTGG - Intergenic
928460292 2:31466098-31466120 GAGGATGAAAAGCAGAAAAGTGG + Intergenic
928521600 2:32094507-32094529 ATGTTTGTGAAGCAGCAAAGAGG + Intronic
928949806 2:36804502-36804524 GTGTGGGTCCAGCAGAAAAGGGG + Intronic
932606094 2:73166607-73166629 GTGTTGGAAAAGCCGAAAACAGG + Intergenic
933926333 2:87093844-87093866 GTGTTGGAAAAGCTGAAAACAGG - Intergenic
936902859 2:117503803-117503825 GTGTCTGAGCAGCAGCAAAGTGG + Intergenic
939013497 2:136874928-136874950 GTGTTTTACAAACAGAGGAGTGG + Intronic
940500414 2:154486789-154486811 TTGTTTAAAAAGCAGGAAAGGGG + Intergenic
940976649 2:159953370-159953392 GTATCTGACAAACAGAGAAGAGG + Intronic
942656389 2:178218519-178218541 ATGTTTGAGAAGCAAACAAGGGG - Intronic
942884973 2:180912177-180912199 GTCTTTCACAGGCAGAAAAGAGG - Intergenic
943065690 2:183083852-183083874 GTCTTGGACAAGCAGAGATGAGG - Intronic
943076184 2:183198048-183198070 GTGTTTGAGAGACAGAAAACTGG - Intergenic
943553990 2:189378422-189378444 CTGTTTAAAAAGGAGAAAAGCGG + Intergenic
944660060 2:201914148-201914170 ATGTTTAAGAAGGAGAAAAGTGG - Intergenic
945224845 2:207523107-207523129 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
946269662 2:218580267-218580289 CTGTTTTAAAAGCAGAAAAGTGG - Intronic
947654037 2:231810921-231810943 GGGTTTGGCAAGCAGAAATGAGG - Intergenic
948359468 2:237409217-237409239 ATGTTTGCCAACCAGAAGAGAGG + Intronic
1168908162 20:1423384-1423406 ATGTCTGAGAAACAGAAAAGAGG + Intergenic
1169230118 20:3882579-3882601 GATTTTGATAAGCAGAAATGTGG + Intergenic
1170833615 20:19864512-19864534 GAATTTGACAAGAAGAAAAAAGG + Intergenic
1171219488 20:23382051-23382073 GTCTCTGTCAAGCAGGAAAGAGG + Intronic
1172127092 20:32630958-32630980 CTGTTTGAAAAAAAGAAAAGAGG + Intergenic
1173325806 20:42032476-42032498 CTGCTCAACAAGCAGAAAAGGGG + Intergenic
1173384377 20:42574424-42574446 CACTTTGGCAAGCAGAAAAGTGG + Intronic
1173741350 20:45404903-45404925 GAGTTCAACAAGCAGAAAAGAGG - Intronic
1174761933 20:53215195-53215217 GTGTTTGCCACGTGGAAAAGTGG - Intronic
1175694316 20:61089972-61089994 GTGCTTGGGAAGCAGCAAAGAGG - Intergenic
1175927755 20:62479372-62479394 GAGTTTGGCAAGAAGAGAAGAGG - Intergenic
1177868455 21:26541168-26541190 GAGTTTTACAAGGAGATAAGAGG + Intronic
1177961623 21:27673894-27673916 GTGATTGGCAAGGAGACAAGAGG + Intergenic
1179945960 21:44676220-44676242 GTTTTTGAACAGCATAAAAGCGG + Intronic
1180113496 21:45678676-45678698 ATGGATGAGAAGCAGAAAAGTGG + Intronic
1180115638 21:45702985-45703007 ATGGATGAGAAGCAGAAAAGTGG - Intronic
1181095243 22:20500602-20500624 TTGGTTTACAAGAAGAAAAGTGG + Intronic
1182917552 22:34049049-34049071 GTGCTTGAAAAACAGAAGAGGGG - Intergenic
1183426225 22:37740884-37740906 CTGTTTGACAGGCAGACAAGAGG + Exonic
1183693068 22:39402107-39402129 GAGTTTGCCAAGCAGAGGAGAGG + Intronic
1183857422 22:40644789-40644811 ATGTTTGACAGGCAGTAATGAGG + Intergenic
1183991926 22:41602896-41602918 ATGTTAGACAAGCAGAGAGGGGG - Intronic
1184612333 22:45612777-45612799 GTGGTTGACAAGCACAACTGTGG - Intergenic
950006021 3:9691480-9691502 ATGCTGGACAGGCAGAAAAGGGG - Intronic
950687212 3:14627281-14627303 GTGTGTGGTAAGCAGAAGAGAGG - Intergenic
951249003 3:20372544-20372566 GTGTTTGGCAGTCAGGAAAGTGG - Intergenic
954372796 3:50177453-50177475 GTGTTGAACAATCAGAAAACAGG - Intronic
954872483 3:53778230-53778252 GTTCTTGGAAAGCAGAAAAGAGG - Intronic
955032687 3:55236614-55236636 GTGTTTCACCATCAGTAAAGTGG - Intergenic
955575778 3:60361338-60361360 GTGTTTGTCAGGCAAAAAAATGG + Intronic
956366480 3:68508967-68508989 GTGTTTGAGAAACAGCAATGAGG + Intronic
956565282 3:70630082-70630104 GTGTTTGAAAAGATGAAACGAGG + Intergenic
957234935 3:77574884-77574906 GAATCTGACAAGCAGAAAAAAGG + Intronic
958002386 3:87766909-87766931 CTGTTTTACAAGCAGGAAACTGG - Intergenic
958131841 3:89436606-89436628 GTGAGTGACAGGCAGAATAGAGG + Intronic
958170181 3:89929393-89929415 GTGTTTGACAAGTTGGAAAATGG + Intergenic
960391924 3:117087915-117087937 GTGGTGGAAAAGCAGAACAGTGG - Intronic
962895708 3:139712711-139712733 GTGTTTGCCAAGAAGCCAAGAGG + Intergenic
962915142 3:139894468-139894490 GTGTTTAAGAAACAGAAAGGAGG + Intergenic
963301730 3:143605033-143605055 GGTTTAGACAAGCAGAAAAGGGG - Intronic
963441897 3:145350508-145350530 GTTTTTGAGAATCATAAAAGAGG + Intergenic
964751737 3:160059975-160059997 GTGTTTTAGAAACAGAATAGTGG - Intergenic
966558784 3:181294992-181295014 TTGTTTGACTAGCAGAAATTAGG - Intergenic
966670504 3:182520791-182520813 GTGTTTGAGAAGCAGATACAAGG - Intergenic
966990101 3:185221020-185221042 ATTTTTAACATGCAGAAAAGAGG - Intronic
968354607 3:198094907-198094929 GAGTTTGAAAAGCAGAGAGGAGG + Intergenic
969482154 4:7452462-7452484 GACTTTGGCCAGCAGAAAAGAGG - Intronic
970552227 4:17193677-17193699 CTGATTGACAAGAAGAACAGTGG - Intergenic
970564503 4:17318529-17318551 GTGTGTGGCAATCAGAAATGGGG - Intergenic
970760140 4:19475828-19475850 GTGTTTGAAAAACAGCAAGGAGG + Intergenic
970874048 4:20849072-20849094 GGTTTTGACAACCAGGAAAGAGG - Intronic
971270680 4:25141857-25141879 GTATTTGAGAAGCAGCAAGGAGG - Intronic
971752196 4:30665080-30665102 TTATTTTAAAAGCAGAAAAGGGG - Intergenic
972503646 4:39700322-39700344 GTGTTTCAGAAGAAGAAAACAGG + Intronic
973222963 4:47750213-47750235 GGGTATGAGAAGCAGAAAAGAGG + Intronic
973656670 4:53055356-53055378 GTGGACGACAGGCAGAAAAGTGG + Intronic
973878423 4:55243915-55243937 GGTTTTGACAAGCAGAGATGAGG + Intergenic
974019567 4:56680809-56680831 GTGTTTGACAAGGGGAAGTGAGG - Intronic
974442029 4:61931114-61931136 CTGTCTCACTAGCAGAAAAGGGG + Intronic
974569049 4:63620109-63620131 GTGTTTGACAACCAGCTATGTGG - Intergenic
974772843 4:66438047-66438069 ATGTTTGATAAGCAGAGATGTGG - Intergenic
975088205 4:70368550-70368572 GTGGTTCACACTCAGAAAAGAGG + Intergenic
975216285 4:71759922-71759944 TAGTTTGACAGGCAGAACAGAGG - Intronic
975406307 4:73994550-73994572 CTGCTAGACAAGGAGAAAAGAGG + Intergenic
975640723 4:76497554-76497576 GTTTTTTAAAATCAGAAAAGAGG + Intronic
975714241 4:77190155-77190177 GTAGCTGACAAGCACAAAAGTGG - Intronic
976540850 4:86273606-86273628 CTGTTTGATAAGTAGAGAAGTGG - Intronic
977446603 4:97139169-97139191 GTGTTTGCCCCCCAGAAAAGTGG + Intergenic
979021935 4:115512894-115512916 ATGTTTGGTAAGCAGAACAGTGG - Intergenic
980101858 4:128549795-128549817 GAGTTTGCAAAGCAGAAAATAGG - Intergenic
980154372 4:129086915-129086937 ATGTGTGTCAGGCAGAAAAGTGG - Intronic
982127853 4:152199889-152199911 GTGTTTTCCCAGCAGACAAGTGG + Intergenic
982634757 4:157880166-157880188 ATGATTGACAAGGAGAAAAGAGG + Intergenic
982864901 4:160498687-160498709 ATGTTTGACATGCAGAAAAGAGG - Intergenic
986995198 5:13599530-13599552 TTGTTTAAAAAACAGAAAAGAGG - Intergenic
987085555 5:14464220-14464242 CTTTTTGAAAAGCAGAAAACTGG + Intronic
987914794 5:24198725-24198747 GTGGTTGCCAAGCAGAAGAGCGG - Intergenic
988870264 5:35382039-35382061 GTTTTTTAAAAGCAGAAATGTGG + Intergenic
990274180 5:54177820-54177842 GAGTTTGCCAAGTAGGAAAGTGG - Intronic
992472060 5:77067576-77067598 GTGTTTGACAAACTGAAAAAGGG - Intergenic
993712890 5:91245365-91245387 GTGCTTGTTAAGCAGAAAGGAGG - Intergenic
994385976 5:99132455-99132477 ATTTTTAAAAAGCAGAAAAGAGG - Intergenic
996487376 5:124052719-124052741 GTCTTTGGAAAGCTGAAAAGTGG + Intergenic
998011824 5:138701489-138701511 GGGTTTGAGGAGCAGAAAGGAGG + Intronic
998211732 5:140204698-140204720 GTCTTTGAGAAGCATACAAGGGG - Intronic
999001213 5:147924957-147924979 TTGTTTTAAAAGGAGAAAAGTGG - Intergenic
999318803 5:150600858-150600880 GTGTTTGTCAAGCAGAATATGGG + Intergenic
999498130 5:152120126-152120148 GTGTTTGAGGGGCAGAAAGGAGG + Intergenic
1000361381 5:160450897-160450919 GTCTTTGAAAAGCAGAAACTTGG - Intergenic
1000496657 5:161992485-161992507 GTGTTTGAGAAACAGAGATGGGG + Intergenic
1000755793 5:165157896-165157918 ATGTTTGAGAATCAGCAAAGAGG - Intergenic
1002086449 5:176778785-176778807 GGGTTTGCCAGGCAGACAAGTGG - Intergenic
1003017903 6:2482708-2482730 GTGGTTGACATGGAGGAAAGGGG + Intergenic
1005085367 6:22000859-22000881 GATCTTGACAAGCAGAAATGAGG - Intergenic
1006189191 6:32197204-32197226 GAGTTTGACAAGGAGGAAATTGG - Intronic
1006722611 6:36167746-36167768 GTGTTATAAAAGCAGAGAAGAGG + Intergenic
1007394226 6:41568434-41568456 GTGATGGAGAAGCAGCAAAGGGG - Intronic
1007656270 6:43452906-43452928 GGGTTTGACAAGGACAAAATAGG + Intronic
1008143278 6:47857244-47857266 GTGTTGGATCAGCAGAAAACTGG + Intergenic
1008573485 6:52837099-52837121 GGCTTTGAAGAGCAGAAAAGGGG - Intronic
1008818944 6:55608026-55608048 GTCTTGGTCTAGCAGAAAAGAGG - Intergenic
1012752840 6:103184697-103184719 GTGGGTGACAAGAAGAAGAGAGG + Intergenic
1013561863 6:111313454-111313476 GTGTTTTACAAACAAAAAAGAGG - Exonic
1013564173 6:111340872-111340894 GTTTTTGACAAGTAAAATAGAGG - Intronic
1015227861 6:130878920-130878942 GTACTTGCCAAGCACAAAAGTGG + Intronic
1015577542 6:134689268-134689290 AAGTTTTACAAGCAGAGAAGCGG + Intergenic
1016616028 6:146049385-146049407 GTGTAAGAAAAGGAGAAAAGGGG - Intronic
1018251277 6:161873006-161873028 CTGGTTGTCAAGCAGAAAACTGG + Intronic
1018695649 6:166389351-166389373 GTGTAAGAGAAGCAGATAAGAGG - Intergenic
1020536927 7:9410762-9410784 GTGTTTGACAAAATGAAAACTGG + Intergenic
1020695888 7:11413787-11413809 GTGTTAGACATGCAAAAAAATGG - Intronic
1020900837 7:14001513-14001535 GAGTTTTACAGGCAGAAAAAAGG - Intergenic
1021804279 7:24339713-24339735 ATGTTTGAGAAACAGGAAAGAGG - Intergenic
1022868189 7:34445104-34445126 GTGTTTGAGGAGCAGAAAGAAGG + Intergenic
1022952640 7:35353165-35353187 GTGTTTGACCAATAGGAAAGTGG + Intergenic
1024440138 7:49407521-49407543 GTTTTTTAAAAGCAAAAAAGGGG - Intergenic
1026332494 7:69364737-69364759 GTGTTGCAAAAGGAGAAAAGTGG + Intergenic
1028531005 7:91838599-91838621 GTGTTTGTCAAGCAGGTAAGAGG - Intronic
1028697928 7:93738071-93738093 CTGATTGGCAAGCAGACAAGAGG - Intronic
1029864702 7:103614978-103615000 GATTTAGACAAGCAGCAAAGAGG - Intronic
1029895163 7:103976016-103976038 GTGTTTGAAGAACAAAAAAGAGG + Intronic
1030689362 7:112516834-112516856 GTGTTTGACAGGCAGACAATAGG - Intergenic
1030855155 7:114546599-114546621 GAGTTTGCCAATCAGATAAGGGG - Intronic
1032418931 7:131762192-131762214 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
1032558177 7:132859787-132859809 GTGTAGGTCAAGGAGAAAAGTGG - Intronic
1032853622 7:135816168-135816190 GTGGTTGAGATGCAGAGAAGTGG + Intergenic
1033395782 7:140972616-140972638 GTGCTTAACAAGGAGGAAAGTGG - Intergenic
1034818541 7:154195935-154195957 GTGTTTGCCAAACCGAAAAAGGG - Intronic
1037528869 8:19755093-19755115 GTGTTAGACATGGAGGAAAGAGG + Intronic
1039047255 8:33461375-33461397 GAGTGTGACAAGCAGAAAGACGG + Exonic
1039173922 8:34781944-34781966 CTGTTTTCCATGCAGAAAAGTGG + Intergenic
1041697918 8:60756993-60757015 TTCTTTGAAAACCAGAAAAGAGG + Intronic
1042080846 8:65049101-65049123 GTGTTTTACAATCAGAACAGTGG + Intergenic
1042973022 8:74431904-74431926 CTGTTTTATAATCAGAAAAGTGG + Intronic
1043652632 8:82616082-82616104 CTGATTGACAAGTAAAAAAGAGG - Intergenic
1044451862 8:92345166-92345188 AAGTTTGACAATCATAAAAGTGG - Intergenic
1044758907 8:95496074-95496096 GTGTTTGAAAACCACAGAAGAGG - Intergenic
1044902253 8:96959220-96959242 ATGCTTGACAGCCAGAAAAGAGG + Intronic
1045364305 8:101461481-101461503 GTGTTTTACGACCAGAAGAGAGG + Intergenic
1046009838 8:108532888-108532910 GTGTTTGGCAAGTAGGAAAGAGG - Intergenic
1046045817 8:108963148-108963170 GTGTTTGAAAAGCAGGAAGAAGG - Intergenic
1048209630 8:132443988-132444010 GTTTCTGATAAGAAGAAAAGGGG - Intronic
1048273033 8:133044614-133044636 GATTCTGACAAGCAGAAAAGGGG + Intronic
1048286587 8:133146481-133146503 GAGGTTGACAAGGAGAAGAGTGG - Intergenic
1048394659 8:134002503-134002525 GTGTTGGAAAAGCAGAAACCAGG - Intergenic
1048718164 8:137291660-137291682 GTGTTTGAGAAGCAGTGAGGAGG - Intergenic
1048822071 8:138389821-138389843 GTGTTTTACCACCACAAAAGGGG + Intronic
1048925383 8:139266630-139266652 ATGTGTGAGAAGCAGGAAAGTGG + Intergenic
1051584275 9:18710568-18710590 GTGTTTGACAAACCTAAGAGAGG + Intronic
1051798475 9:20903663-20903685 CTGTTTGAGAAAGAGAAAAGAGG - Intronic
1055094213 9:72394111-72394133 CTATTTCACAAGCTGAAAAGAGG + Intergenic
1055319864 9:75072680-75072702 GTTTTTGAAAATCAGAAAAAAGG + Intronic
1055611319 9:78028501-78028523 TTGTTTGACAGGGATAAAAGTGG - Intronic
1056292211 9:85155170-85155192 GTCTTGGAGAATCAGAAAAGCGG + Intergenic
1056450102 9:86708478-86708500 AGTTTTGACAAGCAGAAGAGTGG - Intergenic
1056908580 9:90676513-90676535 GAGTTTGACAAGCAAAACATTGG + Intergenic
1059907018 9:118998627-118998649 ACTATTGACAAGCAGAAAAGGGG + Intergenic
1060463670 9:123883024-123883046 GTGTTTGAGGAGCAGAAAGAAGG - Intronic
1187558647 X:20378122-20378144 TTGTTTGACAAGGAGAACAGGGG - Intergenic
1187842277 X:23501134-23501156 TTATTTGACAATCAGATAAGAGG - Intergenic
1188178689 X:27026330-27026352 ATGTTTGCCAAGAAGAAATGAGG - Intergenic
1189140733 X:38602960-38602982 CTGTGTGATAAGCAAAAAAGTGG + Intronic
1191013612 X:55787087-55787109 GTGTGAGTCAAGCAGAAAATTGG - Intergenic
1195462661 X:105145140-105145162 GTGTTAGAAAAGCAGAAATTAGG - Intronic
1195967377 X:110440649-110440671 TTGTTTGAAATGCAGAAAACAGG - Intronic
1196356468 X:114800057-114800079 GTTTTTGAGAGGCAGAAAAGAGG + Intronic
1198772923 X:140150027-140150049 GTGGTTGAGAAGCAGAATGGTGG - Intergenic
1200906430 Y:8487428-8487450 GAATTTGACAAGGAAAAAAGTGG - Intergenic