ID: 1153730495

View in Genome Browser
Species Human (GRCh38)
Location 18:8006600-8006622
Sequence CAGGAAACCATGGGTAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153730487_1153730495 14 Left 1153730487 18:8006563-8006585 CCCGGGAGTGGAATTGGCATATT 0: 1
1: 1
2: 1
3: 14
4: 196
Right 1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 222
1153730488_1153730495 13 Left 1153730488 18:8006564-8006586 CCGGGAGTGGAATTGGCATATTT 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153730495 Original CRISPR CAGGAAACCATGGGTAGAAC TGG Intronic
901839284 1:11943881-11943903 TAGGAAACCAAGGGTACAGCTGG - Intronic
901903715 1:12390206-12390228 CAGGAATCAATGGGTGGAAGAGG - Intronic
902441629 1:16433754-16433776 TTGGAATCCAAGGGTAGAACTGG + Intronic
903555457 1:24189681-24189703 CAGGAGCCCATGGGTGGAGCAGG - Intergenic
905920454 1:41715514-41715536 ATGGGAACCATGGGAAGAACTGG + Intronic
907599068 1:55748522-55748544 CAGGAGACCTTGCTTAGAACAGG - Intergenic
907928048 1:58973116-58973138 CAGGCAACCATGGGGAGATCTGG - Intergenic
909032681 1:70560815-70560837 CAGGAATCCAGGGGTGGAAGTGG - Intergenic
909233458 1:73120829-73120851 CAGGAATCAAGGGGTAGAAATGG + Intergenic
911507691 1:98773982-98774004 CAGGAATCAAGGGGTAGAAATGG + Intergenic
912129712 1:106586575-106586597 CAGGAATCAAGGGGTAGAAATGG - Intergenic
915308084 1:154992646-154992668 CAGGACAGCAGGGGTAGAAGTGG + Intronic
915643896 1:157253187-157253209 GAGGCAACCATGGGTGGAATGGG - Intergenic
915974982 1:160379507-160379529 AAGAAAAGCATTGGTAGAACTGG - Intergenic
916059470 1:161088857-161088879 TAGGAAACCCTGGGGTGAACAGG + Intronic
917217013 1:172689427-172689449 CAGGAATCAACGGGTAGAAATGG - Intergenic
919330405 1:196163338-196163360 CAGGAATCAATGGGTGGAAGTGG + Intergenic
922223018 1:223622840-223622862 CAGGAATCCATGGGGTGAAGTGG - Exonic
923426635 1:233876671-233876693 CAGGAATCAAGGGGTAGAAATGG + Intergenic
1063466413 10:6247979-6248001 CAGGTCACCCTGGGTAGAGCAGG + Intergenic
1064389384 10:14928500-14928522 AAGGACACTATGGGAAGAACTGG + Intronic
1067969506 10:50953833-50953855 CAAGAATCAATGGGTAGAAATGG - Intergenic
1071490074 10:86130311-86130333 CAGGAAATACTGGGTAGAAGAGG + Intronic
1072905867 10:99453074-99453096 AGGGAAACCCTGAGTAGAACAGG - Intergenic
1074461830 10:113645376-113645398 CAGTAACCAATGGGTAGAATAGG + Intronic
1074897302 10:117788179-117788201 CAGGACATCATGGAAAGAACAGG + Intergenic
1074966034 10:118491393-118491415 ATGGAAACCATGGGCAGAAGAGG - Intergenic
1078090945 11:8264158-8264180 CACGAAACCCCGGGCAGAACTGG - Intronic
1080031019 11:27661315-27661337 CAGGGAACCATTGTTAGAAAAGG - Intronic
1081202794 11:40238263-40238285 CAGGAAACAGTGGCTAGAGCAGG - Intronic
1085271622 11:75273295-75273317 CAGCAACCCATGGGCAGAAAGGG + Intronic
1085960056 11:81451050-81451072 CACAAAACAATGGGAAGAACAGG + Intergenic
1087263839 11:96040092-96040114 CAGGAAAACATGAATAGAATAGG - Intronic
1088389311 11:109296870-109296892 CAGTAAACCATGGTTTAAACAGG + Intergenic
1088911028 11:114192729-114192751 CATGAAAGCAAGGGGAGAACCGG + Intronic
1089653130 11:119927905-119927927 CAGGAAGGCAGGGGTAGAAGTGG + Intergenic
1094489571 12:30950728-30950750 CTGGAAACCATGGGTTGAAAAGG - Intronic
1097562960 12:61231494-61231516 CAGCAATCCATGGAAAGAACTGG - Intergenic
1097770400 12:63577799-63577821 CAGGAAACGATGTGGAGAAAAGG + Intronic
1098539805 12:71641648-71641670 CAGGAAAGGCTGGTTAGAACTGG - Intronic
1099363153 12:81731681-81731703 CAGACAACCTTGGGTAGAATTGG + Intronic
1101253320 12:102955838-102955860 CAGGTTACCATGGGGAGAAGGGG + Intronic
1101617108 12:106348733-106348755 TAGGAAAACATGGGCAGAAGAGG - Intergenic
1105019760 12:132808250-132808272 CAGGGAACCCTTGGTAGAATCGG + Exonic
1105523208 13:21150567-21150589 CATGGTACCATGGGTAGAGCAGG - Intergenic
1105882298 13:24615454-24615476 GAGGAACCCATGGGTGGAAGTGG + Intergenic
1106243956 13:27931083-27931105 CAGGAAACACTGGGTAGGAAGGG + Intergenic
1106315797 13:28592168-28592190 CAGCAAACTATGGGGAGATCAGG - Intergenic
1108400483 13:50037194-50037216 TAGGAAACCCAGTGTAGAACTGG - Intergenic
1108471848 13:50774985-50775007 TAGGAAAGCATGGGTATAATGGG - Intronic
1108580425 13:51823439-51823461 CTGGAAACCATGGGTGGAGATGG + Intergenic
1110248297 13:73352938-73352960 CAGCAATCAAGGGGTAGAACTGG - Intergenic
1110296855 13:73877798-73877820 AAGGAAATATTGGGTAGAACAGG + Intronic
1110615658 13:77539022-77539044 GAGGGAACCCTGGGGAGAACTGG - Intronic
1111428042 13:88115367-88115389 CAGTAAAGCATGGATAAAACTGG + Intergenic
1114758047 14:25282424-25282446 CAGGAATCAAGGGGTAGAAGTGG - Intergenic
1115059906 14:29175337-29175359 CAGGAATCAAGGGGTAGAAGTGG + Intergenic
1116419728 14:44719118-44719140 CAGGAAACAATGGGAGAAACTGG + Intergenic
1117390291 14:55256206-55256228 AGGGAAACAATGGGTAGAAGAGG + Intergenic
1118879429 14:69813602-69813624 CAGGAACCCATGCCTAAAACGGG - Intergenic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1120929214 14:89831263-89831285 CAGAAAACCATGGGAAAAGCAGG + Intronic
1121312914 14:92944795-92944817 GAGGAAACCATGGGTTTAGCTGG - Intronic
1121593971 14:95144961-95144983 GAGGAAACCATTGGTAGAAAAGG - Intronic
1123480606 15:20628133-20628155 CAGAAAACCATGAAAAGAACAGG + Intergenic
1123637405 15:22372234-22372256 CAGAAAACCATGAAAAGAACAGG - Intergenic
1125606118 15:40940952-40940974 CAGGAAATCCTGGGGAGAAGGGG - Intergenic
1128290168 15:66472390-66472412 CAGGAAACCATGGTTCCATCTGG - Intronic
1128642998 15:69353681-69353703 CAGGAATCAAAGGGTAGAAATGG + Intronic
1128831333 15:70772102-70772124 CAGGAAGCCATGAGCAGGACTGG + Intergenic
1131308577 15:91267435-91267457 TAGGAACCCATGGAGAGAACCGG - Intronic
1132971465 16:2691334-2691356 AAGGAACCCATGGGAAGAAACGG + Intronic
1136251149 16:29006024-29006046 CAGGAATCCAGGGGTGGAAGTGG + Intergenic
1139557086 16:67719196-67719218 CTGGAAACCATGGGTCCGACGGG + Exonic
1139589569 16:67926058-67926080 AAGGGTACCATGGGTGGAACAGG + Intronic
1139660302 16:68416303-68416325 CAGGGAACAATGGGGAGACCAGG - Intronic
1140156355 16:72431368-72431390 GAGGAACTCATGGGTAGAAGAGG - Intergenic
1142496525 17:309312-309334 CAGGAAGCCATGGACAGAGCAGG - Intronic
1142826934 17:2519224-2519246 CAGGAAACTGTGGGAAGAAGAGG - Intergenic
1144644356 17:16961928-16961950 AAAAAAACCACGGGTAGAACAGG + Intronic
1146471855 17:33131140-33131162 CAGGATCCAATGGGCAGAACGGG + Intronic
1146783329 17:35695948-35695970 CAGGTAACCATGAGTATAACTGG + Intronic
1148398618 17:47332712-47332734 CACGATAACATGGATAGAACTGG - Intronic
1148872669 17:50668007-50668029 CAGGTAACCCTGGGTAGGGCTGG + Exonic
1149242447 17:54665910-54665932 AAGTGAAACATGGGTAGAACTGG - Intergenic
1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG + Intronic
1155787137 18:29915112-29915134 CAGGGAAATATGGGTAGAATAGG + Intergenic
1156487299 18:37474542-37474564 CAGAAAACCATGGAGAGATCTGG - Intronic
1157013822 18:43684447-43684469 CATGACAACATGGATAGAACTGG + Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157386643 18:47263682-47263704 CAGGAAGCCAGGGGAAGGACGGG + Intergenic
1158109811 18:53928733-53928755 CAGGAATCCATGTGTAGTGCAGG + Intergenic
1158654231 18:59314244-59314266 CAGTAAAACATGGGGAGAAAAGG - Intronic
1160430486 18:78808416-78808438 AAGGAAAGCATGGGTTGAGCTGG + Intergenic
1163637408 19:18443722-18443744 CAGGGACCCATGGGCAGAGCTGG - Exonic
1164524078 19:29000686-29000708 CAGAAAACCAGGGGAAGAGCTGG - Intergenic
1165896216 19:39142754-39142776 CAGGCAGCCAAGGGTAGAGCTGG - Intronic
1166627346 19:44370834-44370856 CAGTAAACCATAGGAAGATCTGG + Intronic
1166712368 19:44945553-44945575 CAGGAATCAATGAGTAGAAGAGG + Intronic
1167394188 19:49216948-49216970 CATGAAGCCATGGGTATAAATGG - Intergenic
1167502554 19:49856091-49856113 CAGGAGACCAGGGGCAGACCAGG + Intronic
1168452946 19:56479963-56479985 CAGGAACCCATGGGAATTACAGG + Intergenic
926114133 2:10200820-10200842 CAGGACACAATTGGAAGAACTGG - Intronic
926287790 2:11503902-11503924 CCTGAAACCATGGCTAGTACTGG + Intergenic
926826965 2:16915116-16915138 CAGGAATCAAAGGGTAGAAGTGG + Intergenic
927315572 2:21677305-21677327 CAGGGAACAAGGGGTAGAAATGG - Intergenic
927845244 2:26468252-26468274 CAGTAATCCATGGGCAGTACTGG - Intronic
928513521 2:32023377-32023399 CAGCAACACATTGGTAGAACAGG + Intronic
928552296 2:32384487-32384509 CAGAAAACTATGGACAGAACAGG + Intronic
930647606 2:53928689-53928711 CCTGAAACCATGGATAGTACTGG - Intronic
934077930 2:88443576-88443598 CAGGAAAACATGGGAAGGAGGGG + Intergenic
935176994 2:100657437-100657459 GAGGAGACCATGGCTAAAACAGG - Intergenic
937024903 2:118689875-118689897 CAAGTAACCCTGGGCAGAACTGG - Intergenic
942837711 2:180320354-180320376 AAAGAACCCCTGGGTAGAACAGG - Intergenic
942988053 2:182165166-182165188 CAGGAATCAATAGGTAGAAATGG + Intronic
944771086 2:202914832-202914854 GAGTAAAACATGGGTAGAAATGG + Intronic
946143257 2:217709777-217709799 CAGAACACCATGGGTACAGCAGG - Intronic
946242976 2:218367988-218368010 CAGGAAACCAGGGGTCGGGCTGG + Exonic
947022190 2:225691784-225691806 CAGGAGACCATGGATAGCATTGG - Intergenic
948413211 2:237780948-237780970 TAGGAAACCACGGGTCGGACAGG + Intronic
1169465571 20:5835358-5835380 CAGGAGACCATAGCTAGAACAGG + Intronic
1171436326 20:25127397-25127419 CAGGAATCTAGGGGTAGAAATGG + Intergenic
1173365686 20:42382598-42382620 CAGGAAAACAGGGGGAGAAGGGG + Intronic
1174531498 20:51217965-51217987 CAGGAATCAAGGGGTAGAAATGG + Intergenic
1177387062 21:20422429-20422451 CAGGAAACAATGGGAATAATTGG - Intergenic
1178274921 21:31228510-31228532 CAGCAAATCATGGGTGAAACTGG + Intronic
1183173416 22:36204484-36204506 CAGGAAAGCAGTGGTAGAGCCGG - Intronic
950175701 3:10872764-10872786 AAAGAAACCCTGGGTTGAACAGG + Intronic
954054415 3:48009717-48009739 CAGGAATCGAGGGGTGGAACTGG + Intronic
955316630 3:57944432-57944454 CAGTGAACCATGGGAAGAATGGG + Intergenic
955323453 3:57991692-57991714 CAGGAAACCGTGGGAAGTCCAGG - Intergenic
955849009 3:63199351-63199373 CAGGAAACTATTGGTACATCTGG + Intergenic
956307059 3:67837083-67837105 CAGGAATCAAGGGGTAGAAGTGG + Intergenic
957396569 3:79646753-79646775 CACAGAAACATGGGTAGAACTGG + Intronic
959065261 3:101649243-101649265 AAGGAAATAATGGGTAGAAGAGG - Exonic
961799543 3:129435605-129435627 CATAAAATCATGGGTAGAACTGG + Intronic
962162690 3:133015743-133015765 CACGATAACATGGGTGGAACTGG - Intergenic
962685986 3:137848123-137848145 CAGGAAGTCATGGGAAGAAGGGG - Intergenic
962947186 3:140182790-140182812 CAGGATGCCATGGACAGAACTGG - Intronic
963452314 3:145498072-145498094 CTTGAAACCATGGTTAGAAAAGG + Intergenic
963453792 3:145517744-145517766 CAGGAATCAAGGGGTAGAAGTGG + Intergenic
963483362 3:145904353-145904375 TGGGCAACCATGGGTAGACCAGG - Intergenic
963970111 3:151420502-151420524 CAGGAATCAAGGGGTAGAAGTGG - Intronic
966298006 3:178446148-178446170 AAGGAAAACATGGCTAGAAGTGG + Intronic
966881988 3:184355674-184355696 CAGGTAACCACAGGCAGAACAGG - Exonic
968948810 4:3679631-3679653 CAGGAACCCCTGGGAAGAGCAGG - Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
974495837 4:62625573-62625595 CAGGAATCCCTGGGTGGAAGTGG - Intergenic
974975907 4:68890748-68890770 CTGGAAAAAATGGGAAGAACTGG + Intergenic
976940273 4:90692379-90692401 CAGGAAACCATGAGGTGAAACGG - Intronic
977063625 4:92287008-92287030 CAGGAAACAATAGGAAAAACAGG - Intergenic
977496875 4:97786966-97786988 CCTGAAACCATGGGCAGTACTGG - Intronic
979138743 4:117146240-117146262 CAGGAATCAAAGGGTAGAAGTGG + Intergenic
980021293 4:127713167-127713189 CAGGCTACTGTGGGTAGAACAGG + Intronic
980532296 4:134071158-134071180 CAGGAAGCCATGAGCTGAACAGG - Intergenic
982068425 4:151674242-151674264 GAGGAAACCATTGGGAGAAAGGG + Intronic
982235786 4:153249878-153249900 CAGGAACCCATAGTTAGCACCGG + Intronic
982892621 4:160875318-160875340 CAGGAAAACATGGGGAGGCCAGG - Intergenic
983862412 4:172724020-172724042 CAGGAAACCATGTGAAACACTGG + Intronic
984816988 4:183848172-183848194 CAGGAAACCTGGGGATGAACAGG + Intergenic
985980519 5:3458512-3458534 CAGGTATCTATGGGCAGAACCGG - Intergenic
987504588 5:18751290-18751312 CAGGAATCAAGGGGTAGAATTGG + Intergenic
987592054 5:19942573-19942595 CAGGAAAACATGAGTAAAAATGG - Intronic
992243157 5:74791306-74791328 CAGGAATCCAGGGGTAAAAGTGG + Intronic
993947345 5:94131669-94131691 CAGGAAACAAGAGGTAGAAGAGG - Intergenic
995943194 5:117609880-117609902 CACAAAAACATGGGTGGAACTGG - Intergenic
996164768 5:120211062-120211084 CAGGAATCAAGGGGTAGAAGTGG - Intergenic
996381533 5:122867002-122867024 CAGGAATCAAGGGGTAGAAATGG - Intronic
997374237 5:133385397-133385419 CAGGAACCCATGAGTGGTACCGG - Intronic
1000217368 5:159174076-159174098 CAGAAAACCATGAAAAGAACAGG + Exonic
1000868661 5:166547555-166547577 CAGGAAACAATGGAAACAACAGG - Intergenic
1002795257 6:466495-466517 TTGGAAAGCATGGGTAGGACAGG + Intergenic
1005392051 6:25343854-25343876 CCGTACACCATGGGTAGAGCTGG + Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1006982193 6:38155511-38155533 CAGGAAACCATGGGTGGGAGTGG + Intergenic
1007475389 6:42116419-42116441 CAGGAAGTGATGGGCAGAACTGG - Intronic
1010356478 6:74939827-74939849 CAGGCAACCTGGGCTAGAACTGG - Intergenic
1012820976 6:104084215-104084237 CAGGAATCAAGGGGTAGAAGTGG + Intergenic
1012882700 6:104810165-104810187 CAGGACACTATGGAAAGAACTGG + Intronic
1013842891 6:114419193-114419215 CAGGAAACATTTGGAAGAACAGG + Intergenic
1015204157 6:130616218-130616240 CAGGAAAACAGGGGTAGAGATGG - Intergenic
1015887520 6:137933633-137933655 CAGGAACACATGGGCAGATCTGG - Intergenic
1016147125 6:140691260-140691282 CAGGAATCAAGGGGTAGAAGTGG - Intergenic
1016544264 6:145202787-145202809 CAGGAATCTATGGGTTGAAATGG - Intergenic
1018031035 6:159841918-159841940 CAGAAAAGCATAGGTAGAACGGG - Intergenic
1018968987 6:168512237-168512259 CAGGAAGTCGTGGGCAGAACAGG + Intronic
1019090819 6:169531560-169531582 CATGAGACCATGAGTAGAGCAGG - Intronic
1023782263 7:43668033-43668055 CAGGACACAATTGGTAAAACTGG + Intronic
1024281276 7:47721763-47721785 CAGGAAGCAAGGGGCAGAACAGG + Intronic
1024866298 7:53907796-53907818 CAGGAAGCAAGGGGTAGAAGTGG + Intergenic
1024975831 7:55112782-55112804 CAGGTAGCCATTGGTAGAGCAGG + Intronic
1026933448 7:74238063-74238085 CAGGAAACCATGGCTTCCACCGG - Intronic
1027406856 7:77871569-77871591 CAGGAATCAAGGGGTAGAATTGG - Intronic
1027685990 7:81279400-81279422 CAGGAATCAAGGGGTGGAACTGG + Intergenic
1029146337 7:98448764-98448786 CAGGAAACTATGGGTAGGAGAGG + Intergenic
1031577733 7:123436690-123436712 TGGGAAATCATGGGTAGAGCTGG - Intergenic
1032533206 7:132638683-132638705 CCAGAAACCATGGGTACAAATGG - Intronic
1034060080 7:148079297-148079319 CTGGAAGCCAAGGGTAGAAGGGG + Intronic
1035824731 8:2631995-2632017 AAGGAAATCTTGGGTAGAAGAGG - Intergenic
1036483853 8:9162263-9162285 CAGGAAGGCAGGGGCAGAACTGG + Intronic
1037645320 8:20787584-20787606 AAGCACACCATGTGTAGAACAGG - Intergenic
1037676411 8:21054740-21054762 CAGTAAATCAAGGGTAGAACTGG + Intergenic
1041237835 8:55822394-55822416 CAGCAAATTATTGGTAGAACTGG + Intronic
1041471424 8:58212884-58212906 CAGGAAATCATGGATACCACTGG + Intergenic
1042334208 8:67613672-67613694 CGGGAAATCCTGGGTAGAAGAGG + Intronic
1044285774 8:90410991-90411013 CAGGAATCAAGGGGTAGAAGTGG - Intergenic
1050041787 9:1503758-1503780 AGGGAAACAATGGGTAGAAGAGG + Intergenic
1050902031 9:10961367-10961389 CAGGAATCAAGGGGTAGAAGTGG + Intergenic
1051065293 9:13094942-13094964 GAGTAAGCCATGGGTAGAAAGGG + Intergenic
1051288859 9:15525244-15525266 CAGGAACCCAGGGTTGGAACAGG - Intergenic
1052088975 9:24303808-24303830 CAGCAAACCTTGGGAAGAAAGGG - Intergenic
1052874951 9:33551800-33551822 AAGGACAGCATGGGTAAAACTGG - Intronic
1054929285 9:70619271-70619293 CCGGATACCATGTATAGAACTGG + Intronic
1054953764 9:70884455-70884477 CAGGCAAGCAGGGGCAGAACTGG + Intronic
1056519001 9:87382674-87382696 CCTGAAACCATGGGTAGTACTGG + Intergenic
1057680471 9:97177023-97177045 AAGGACAGCATGGGTAAAACTGG + Intergenic
1059196304 9:112374414-112374436 CAGGAATCAAGGGGTAGAAGTGG - Intergenic
1059353467 9:113682565-113682587 CTGGAAACCACCGGGAGAACTGG - Intergenic
1059893503 9:118832890-118832912 CAGGAATCAATGGGTGGAAATGG + Intergenic
1060426318 9:123509718-123509740 CAGCATACAATGGATAGAACAGG - Intronic
1060878457 9:127100581-127100603 CAGGAAGCCTTGGGTACAACTGG - Intronic
1060923760 9:127441046-127441068 CAAGAAGCCATGGGAAGAAGGGG - Intronic
1062052093 9:134452875-134452897 GAGGCAACCATGGGTAGAGGAGG + Intergenic
1062269799 9:135703187-135703209 CAGGGAACCCTGGGCAGAGCCGG + Intronic
1187424589 X:19165653-19165675 CAGGAAAGTATTGGTAGAGCGGG - Intergenic
1187647355 X:21363112-21363134 CAGGAAGCCATGGAAAGAAATGG - Intergenic
1188108748 X:26172735-26172757 CAGGAAACAATGGGTTCTACAGG + Intergenic
1189596596 X:42573133-42573155 CAGGAATCAAGGGGTAGAAGGGG + Intergenic
1190154670 X:47979778-47979800 CAGGAAACAAAGGGAAAAACTGG + Intronic
1190365941 X:49695327-49695349 CCGGAAACAATGGGAAGGACTGG - Intronic
1192634406 X:72804185-72804207 CAGGTGACCATGGGGAGCACTGG + Intronic
1192647304 X:72916616-72916638 CAGGTGACCATGGGGAGCACTGG - Intronic
1194905481 X:99570826-99570848 CAGGAAGCCATTGGAGGAACTGG - Intergenic
1200705542 Y:6439452-6439474 CAGGAAACCATTGGCTGAAAAGG + Intergenic
1200743115 Y:6876954-6876976 CATGAACCCATGAGTAGAAAGGG - Intergenic
1201028569 Y:9725256-9725278 CAGGAAACCATTGGCTGAAAAGG - Intergenic
1201285937 Y:12378713-12378735 CAGGAAACCATGGAGAGGACCGG + Intergenic